Thyraylia hollandana

(Kearfott, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Thyraylia

At a glance

Occurrence records84

Data sources5

Biological traits0

DNA specimens43

eDNA detections45

Sources5 archives

Databases and archives Thyraylia hollandana's data was compiled from.

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD43 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thyraylia hollandana has left across the world's sequence archives.

At a glance

DNA specimens43

BINs3

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

40Avariable

52Avariable

55Tmostly conserved

106Cvariable

115Tvariable

133Tvariable

157Tvariable

202Avariable

235Tvariable

268Avariable

281Avariable

368Avariable

400Tvariable

556Avariable

616Cvariable

646Cvariable

653Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes8

BINs3

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thyraylia voxcanasame genus1.5%Thyraylia bunteanasame genus1.5%Thyraylia banasame genus2.4%Thyraylia discanasame genus3.0%Thyraylia nanasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor72

Museum / vouchered12

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 55≤1 km 10≤10 km 3>10 km 2

70 georeferenced · 2 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Smithsonian Institutionlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 9 of 12 vouchered records shown · 3 without an institution code

09Environmental DNA45 detections

Where the DNA of Thyraylia hollandana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

Riparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 15.2–27.4

Seasonal swing summer↔winter25.7 °C

Max temp (day)28.2 °C 19.2–33.0

Min temp (night)18.5 °C 13.6–23.1

Precipitation97.8 mm/mo 79.6–117

Air humidity58.2 % 54.6–61.7

Moisture balance-48.9 mm/mo -116–16.0

Vapour deficit1,223 Pa 659–1,665

Wind speed3.80 m/s 2.60–4.40

Cloud cover32.3 % 27.2–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)