Thyraylia bunteana

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Thyraylia

At a glance

Occurrence records162

Data sources5

Biological traits0

DNA specimens6

eDNA detections2

Sources5 archives

Databases and archives Thyraylia bunteana's data was compiled from.

GBIFGlobal Biodiversity Information Facility162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF162 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thyraylia bunteana has left across the world's sequence archives.

At a glance

DNA specimens6

BINs4

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

46Tmostly conserved

49Tmostly conserved

50Tmostly conserved

55Tmostly conserved

82Cmostly conserved

88Tvariable

101Gmostly conserved

106Tmostly conserved

127Amostly conserved

163Avariable

166Avariable

172Cvariable

178Tvariable

190Amostly conserved

202Avariable

220Tmostly conserved

235Tmostly conserved

266Cmostly conserved

271Avariable

284Cvariable

286Tvariable

337Gvariable

368Amostly conserved

370Avariable

373Avariable

397Tvariable

400Cvariable

406Tvariable

436Tmostly conserved

439Cvariable

445Tvariable

451Avariable

454Tmostly conserved

469Avariable

483Gvariable

490Tmostly conserved

499Tmostly conserved

571Tmostly conserved

596Tmostly conserved

616Cvariable

634Cvariable

637Avariable

646Cvariable

653Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes3

BINs3

Most divergent pair4.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thyraylia hollandanasame genus1.5%Thyraylia voxcanasame genus2.7%Thyraylia banasame genus2.7%Thyraylia discanasame genus3.6%Thyraylia nanasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type162 records

Wild obs. + sensor20

Museum / vouchered142

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 6≤1 km 3≤10 km 4>10 km 2

15 georeferenced · 5 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 14≤1 km 9≤10 km 15>10 km 6

44 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	112
Champaign, US	11
New Haven, US	8
Cambridge, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Smithsonian Institutionlocation not on record	1
St. Paul, US	1

7 institutions · 140 of 142 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Thyraylia bunteana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.6–20.0

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.9 °C 24.7–25.1

Min temp (night)15.8 °C

Precipitation86.2 mm/mo 77.1–95.2

Air humidity59.5 % 58.4–60.6

Moisture balance-27.2 mm/mo -42.6–-11.8

Vapour deficit938 Pa 899–977

Wind speed2.80 m/s 2.70–2.90

Cloud cover41.2 % 38.9–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)