Thalassodes quadraria

Guenée · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Thalassodes

At a glance

Occurrence records140

Data sources7

Biological traits0

DNA specimens74

eDNA detections53

Sources7 archives

Databases and archives Thalassodes quadraria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 12 countries53 detections

DNA & barcodingBOLD74 specimens

01Narrative

Thalassodes quadraria is a species of moth of the family Geometridae first described by Achille Guenée in 1857. It is found in Africa south of the Sahara and in India and Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thalassodes quadraria has left across the world's sequence archives.

At a glance

DNA specimens74

BINs3

Marker genes1

eDNA detections53

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

31Amostly conserved

50Cvariable

82Cmostly conserved

100Gvariable

115Tvariable

136Tmostly conserved

166Amostly conserved

178Cvariable

200Avariable

214Gvariable

238Tmostly conserved

265Amostly conserved

271Tvariable

283Amostly conserved

298Cvariable

316Avariable

322Tvariable

325Amostly conserved

364Cmostly conserved

401Tvariable

508Avariable

559Gvariable

578Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTCTAAGTTTATTAATTCGAGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes24

BINs3

Most divergent pair9.0%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thalassodes immissariasame genus6.5%Pelagodes verariasame family6.7%Pelagodes pilariasame family7.1%Thalassodes pilariasame genus7.3%Thalassodes umbrimediasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type140 records

Wild obs. + sensor96

Museum / vouchered44

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 63≤1 km 4≤10 km 1>10 km 6

74 georeferenced · 22 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 44 records without

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	35
Bavarian State Collection of Zoologylocation not on record	4
Research Collection of Roy W. Gofflocation not on record	1
Durban Natural Science Museumlocation not on record	1

4 institutions · 41 of 44 vouchered records shown · 3 without an institution code

09Environmental DNA53 detections

Where the DNA of Thalassodes quadraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 18.7–26.0

Seasonal swing summer↔winter4.10 °C

Max temp (day)26.4 °C 22.6–30.2

Min temp (night)17.8 °C 14.6–24.8

Precipitation49.6 mm/mo 7.20–189

Air humidity60.5 % 44.8–69.8

Moisture balance-94.4 mm/mo -137–58.2

Vapour deficit1,171 Pa 622–1,558

Wind speed2.50 m/s 0.7–4.00

Cloud cover31.0 % 12.2–63.8

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)