Thalassodes immissaria

Walker, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Thalassodes

At a glance

Occurrence records83

Data sources8

Biological traits0

DNA specimens16

eDNA detections22

Sources8 archives

Databases and archives Thalassodes immissaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 4 countries22 detections

DNA & barcodingBOLD16 specimens

01Narrative

Thalassodes immissaria is a moth of the family Geometridae first described by Francis Walker in 1861. It is found in the Oriental tropics of China, India, Sri Lanka, Hong Kong, Japan, Borneo, Vietnam, Sumatra, Sulawesi and the Ryukyu Islands. The populations in Ryukyu are often classified as a subspecies - Thalassodes immissaria intaminata Inoue, 1971. It is a green moth with faint white lines. There is a very narrow yellowish line border the wings. Male has plumose (feather-like) antennae, female has filiform (thread-like) antennae. It is very similar to other congener species, therefore separation should done through examination of genitalis. In the male, the genitalia possess a long, tongue-like valva basal process and a tongue-like harpe. The caterpillar feeds on Mangifera indica, Lagerstroemia, Nephelium, Eucalyptus camaldulensis, Dimocarpus longan and Litchi chinensis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thalassodes immissaria has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes1

eDNA detections22

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

91Tmostly conserved

106Tmostly conserved

115Tmostly conserved

200Gmostly conserved

220Cmostly conserved

277Tmostly conserved

283Tmostly conserved

352Cmostly conserved

424Amostly conserved

517Amostly conserved

532Cmostly conserved

565Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes3

BINs3

Most divergent pair1.4%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thalassodes dorsipunctatasame genus2.7%Thalassodes linguissitasame genus3.3%Pelagodes pilariasame family3.5%Thalassodes pilariasame genus3.8%Thalassodes umbrimediasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor81

Museum / vouchered2

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 38≤1 km 22≤10 km 4>10 km 11

75 georeferenced · 6 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Research Collection of Manfred Sommererlocation not on record	1
ZSMlocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Thalassodes immissaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map4 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 23.0–27.1

Seasonal swing summer↔winter5.10 °C

Max temp (day)26.7 °C 25.0–28.5

Min temp (night)22.8 °C 19.6–26.0

Precipitation206 mm/mo 164–272

Air humidity66.4 % 63.2–69.8

Moisture balance67.1 mm/mo

Vapour deficit1,049 Pa 833–1,317

Wind speed3.00 m/s

Cloud cover49.7 % 28.1–67.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)