Tabanus quinquevittatus

Wiedemann, 1821 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records986

Data sources7

Biological traits0

DNA specimens12

eDNA detections46

Sources7 archives

Databases and archives Tabanus quinquevittatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility986 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF986 records

Environmental DNA1 datasets · 2 countries46 detections

DNA & barcodingBOLD12 specimens

01Narrative

Tabanus quinquevittatus is a species of horse fly in the family Tabanidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus quinquevittatus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections46

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

201Gmostly conserved

483Amostly conserved

486Amostly conserved

ATTTTTGGTGCATGAGCCGGAATAATTGGTACTTCATTAAGTATTTTAATTCGAGCTGAATTAGGTCATCCAGGATCATTAATTGGTGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.48%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus nigrovittatussame genus3.0%Tabanus mularissame genus4.7%Tabanus superjumentariussame genus6.1%Tabanus longiusculussame genus6.3%Tabanus trimaculatussame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type986 records

Wild obs. + sensor59

Museum / vouchered927

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 23≤1 km 8≤10 km 2

33 georeferenced · 26 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 15≤1 km 195≤10 km 326>10 km 56

592 georeferenced · 335 without coordinates

Open the institutions mapphysical evidence927

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	224
Champaign, US	192
East Lansing, US	132
Mississippi State, US	111
UNHClocation not on record	99
New Haven, US	61
Chicago, US	44
Cleveland Museum of Natural History, OH (CLEV)location not on record	33
CUlocation not on record	7
Cambridge, US	4
Lubbock, US	4
Lake Placid, US	4
Albuquerque, US	3
Vancouver, CA	2
University Park, US	2
Chicago, US	1
Natural History Museum of Utahlocation not on record	1

17 institutions · 924 of 927 vouchered records shown · 3 without an institution code

09Environmental DNA46 detections

Where the DNA of Tabanus quinquevittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map2 countries0

GrasslandMixed habitat14. Artificial - Terrestrial | 14.2 Pasturel…1. Forest & Woodland|1.4. Temperate Forestfarm1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 14.9–23.5

Seasonal swing summer↔winter26.0 °C

Max temp (day)27.6 °C 17.9–27.8

Min temp (night)19.2 °C 12.6–19.6

Precipitation93.6 mm/mo 80.1–109

Air humidity59.8 % 57.2–60.8

Moisture balance-61.3 mm/mo -76.0–-49.9

Vapour deficit1,137 Pa 683–1,218

Wind speed3.90 m/s 2.90–4.00

Cloud cover38.2 % 35.9–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)