Tabanus nigrovittatus

Macquart, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records746

Data sources7

Biological traits0

DNA specimens38

eDNA detections37

Sources7 archives

Databases and archives Tabanus nigrovittatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility745 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS746 records

Environmental DNA1 datasets · 1 countries37 detections

DNA & barcodingBOLD38 specimens

01Narrative

Tabanus nigrovittatus, also known as the greenhead horse fly, salt marsh greenhead, or simply the greenhead fly, greenhead or greenfly, is a species of biting horse-fly commonly found around coastal marshes of the Eastern United States. They are much smaller than most horsefly species, instead being close in size to a common housefly. The biting females are a considerable pest to both humans and animals while they seek a source of blood protein to produce additional eggs. Females live for three to four weeks and may lay about 100 to 200 eggs per blood meal. Affected coastal communities install black box traps in marsh areas to reduce and control T. nigrovittatus populations.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus nigrovittatus has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes3

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

10Cmostly conserved

84Tmostly conserved

141Gmostly conserved

162Tvariable

166Cvariable

195Tvariable

223Cvariable

234Gvariable

243Tvariable

253Gvariable

273Tvariable

336Avariable

351Cvariable

372Cvariable

381Avariable

393Gvariable

414Tvariable

456Amostly conserved

459Amostly conserved

460Cvariable

474Cvariable

486Tvariable

508Tvariable

522Amostly conserved

541Cmostly conserved

564Cmostly conserved

GGTACTTCACTAAGTATTTTAATTCGAGCTGAATTAGGTCACCCAGGATCATTAATTGGTGATGATCAAATTTATAATGTAATTGTAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes4

BINs2

Most divergent pair1.1%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus quinquevittatussame genus3.0%Tabanus mularissame genus3.9%Tabanus pallidescenssame genus6.3%Tabanus longiusculussame genus6.5%Tabanus superjumentariussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type746 records

Wild obs. + sensor9

Museum / vouchered737

Origin

Native1

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 4 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 57≤10 km 413>10 km 3

473 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence737

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	238
Chicago, US	128
UNHClocation not on record	96
CUlocation not on record	71
East Lansing, US	62
Mississippi State, US	61
Tapachula, MX	30
Lubbock, US	24
Cambridge, US	14
Montecillo, Texcoco, MX	4
Chicago, US	2
University of Guelphlocation not on record	2
Champaign, US	2
Albuquerque, US	1
San Francisco, US	1
Los Angeles, US	1

16 institutions · 737 of 737 vouchered records shown

09Environmental DNA37 detections

Where the DNA of Tabanus nigrovittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter9.10 °C

Max temp (day)29.6 °C

Min temp (night)22.4 °C

Precipitation91.0 mm/mo

Air humidity59.4 %

Moisture balance-86.1 mm/mo

Vapour deficit1,344 Pa

Wind speed2.80 m/s

Cloud cover27.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)