Tabanus glaucopis

Meigen, 1820 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records299

Data sources6

Biological traits0

DNA specimens11

eDNA detections21

Sources6 archives

Databases and archives Tabanus glaucopis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF299 records

Environmental DNA3 datasets · 5 countries21 detections

DNA & barcodingBOLD11 specimens

01Narrative

Tabanus glaucopis, also known as the downland horsefly, is a species of biting horse-fly.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus glaucopis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections21

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

22Gvariable

25Avariable

46Tvariable

50Cvariable

145Amostly conserved

163Amostly conserved

181Amostly conserved

187Cvariable

197Tvariable

205Amostly conserved

212Cvariable

214Tvariable

220Tmostly conserved

238Tmostly conserved

250Cvariable

259Tmostly conserved

263Tvariable

265Amostly conserved

271Tvariable

274Amostly conserved

301Tmostly conserved

313Tmostly conserved

316Gvariable

325Tvariable

340Cvariable

343Cvariable

364Cvariable

379Amostly conserved

397Cmostly conserved

403Cvariable

406Tmostly conserved

421Tmostly conserved

424Avariable

433Gvariable

474Tvariable

542Tmostly conserved

580Tmostly conserved

592Gvariable

610Tmostly conserved

616Tvariable

631Avariable

641Tmostly conserved

AACATTATATTTTATTTTTGGGGCATGAGCCGGAATAATCGGTACTTCACTAAGTATTTTAATTCGAGCTGAATTAGGGCACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes6

BINs3

Most divergent pair4.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hybomitra micanssame family5.6%Tabanus bifariussame genus5.7%Hybomitra aequetinctasame family5.9%Hybomitra sexfasciatasame family6.1%Hybomitra rhombicasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type299 records

Wild obs. + sensor225

Museum / vouchered70

Other4

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 81≤1 km 36≤10 km 74>10 km 1

192 georeferenced · 33 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 13≤1 km 13≤10 km 26

52 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	16
UNHClocation not on record	7
ZSMlocation not on record	6
MZLUlocation not on record	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Mississippi State, US	5
Instituto de Investigação Científica Tropicallocation not on record	5
Stockholm, SE	4
neflocation not on record	2
BioFokuslocation not on record	1
Gothenburg, SE	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Tilburg, NL	1
NHMOlocation not on record	1

14 institutions · 61 of 70 vouchered records shown · 9 without an institution code

09Environmental DNA21 detections

Where the DNA of Tabanus glaucopis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys3

Countries5

Verifiable raw sequence linked12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map5 countries0

ziemlich windig (ideal fur Waldlichtung)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 16.2–17.8

Seasonal swing summer↔winter19.5 °C

Max temp (day)21.4 °C 19.8–22.8

Min temp (night)13.9 °C 11.5–13.9

Precipitation67.9 mm/mo 67.2–87.8

Air humidity59.3 % 56.8–59.7

Moisture balance-55.0 mm/mo -62.1–-8.50

Vapour deficit811 Pa 754–899

Wind speed3.10 m/s 2.40–3.10

Cloud cover46.1 % 35.0–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)