Hybomitra micans

(Meigen, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Hybomitra

At a glance

Occurrence records135

Data sources5

Biological traits2

DNA specimens5

eDNA detections5

Sources5 archives

Databases and archives Hybomitra micans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF135 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

De glanzende knobbeldaas is een vliegensoort uit de familie van de dazen (Tabanidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1804 door Meigen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)predator

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hybomitra micans has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

325Tvariable

AACATTATATTTTATTTTTGGTGCATGAGCTGGAATAATTGGTACTTCATTAAGTATTTTAATTCGAGCTGAATTAGGGCATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hybomitra rhombicasame genus2.3%Hybomitra aterrimasame genus2.4%Hybomitra sexfasciatasame genus2.6%Hybomitra kauriisame genus3.0%Hybomitra aequetinctasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type135 records

Wild obs. + sensor109

Museum / vouchered25

Other1

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 42≤1 km 15≤10 km 48

105 georeferenced · 4 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 7≤1 km 8≤10 km 6

21 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CBDClocation not on record	11
Tilburg, NL	5
ZSMlocation not on record	4
NCMGlocation not on record	2
East Lansing, US	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1

6 institutions · 25 of 25 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Hybomitra micans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 10.6–16.5

Seasonal swing summer↔winter19.2 °C

Max temp (day)17.7 °C 14.9–20.6

Min temp (night)8.00 °C 4.70–11.6

Precipitation209 mm/mo 165–245

Air humidity62.9 % 61.7–63.4

Moisture balance107 mm/mo 48.8–152

Vapour deficit599 Pa 474–704

Wind speed3.10 m/s 2.20–3.40

Cloud cover38.2 % 36.8–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)