Tabanus calens

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records693

Data sources7

Biological traits0

DNA specimens11

eDNA detections19

Sources7 archives

Databases and archives Tabanus calens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility693 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF693 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD11 specimens

01Narrative

Tabanus calens is a species of horse fly in the family Tabanidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus calens has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

281Tvariable

505Gmostly conserved

ATCTTTGGAGCATGGGCTGGAATAATTGGTACTTCATTAAGTATTTTAATTCGAGCTGAATTAGGACATCCAGGATCATTAATTGGAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.32%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus sudeticussame genus3.5%Tabanus bovinussame genus3.7%Tabanus novaescotiaesame genus3.7%Tabanus spodopterussame genus3.9%Tabanus chrysurussame genus3.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type693 records

Wild obs. + sensor133

Museum / vouchered560

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 73≤1 km 19≤10 km 4>10 km 14

110 georeferenced · 23 without coordinates

Open the mapobservation + sensor133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 8≤1 km 148≤10 km 259>10 km 12

427 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence560

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	174
Champaign, US	145
UNHClocation not on record	67
Cleveland Museum of Natural History, OH (CLEV)location not on record	44
University of Guelphlocation not on record	26
East Lansing, US	26
OSUClocation not on record	22
New Haven, US	15
Chicago, US	13
Wuzhou, CN	7
Lubbock, US	5
University Park, US	5
Paris, FR	1
Albuquerque, US	1
CUlocation not on record	1

15 institutions · 552 of 560 vouchered records shown · 8 without an institution code

09Environmental DNA19 detections

Where the DNA of Tabanus calens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)30.8 °C 30.8–31.0

Min temp (night)20.8 °C 20.8–21.2

Precipitation94.8 mm/mo 90.8–94.8

Air humidity57.4 % 57.1–57.4

Moisture balance-62.6 mm/mo -73.1–-62.6

Vapour deficit1,357 Pa 1,357–1,402

Wind speed2.40 m/s 2.40–2.60

Cloud cover32.0 % 31.4–32.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)