Tabanus bovinus

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Tabanus

At a glance

Occurrence records1 432

Data sources6

Biological traits0

DNA specimens7

eDNA detections1

Sources6 archives

Databases and archives Tabanus bovinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 432 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Le taon des bœufs est une espèce de taons hématophages pour la femelle qui, comme son nom l'indique, préfère se nourrir du sang de bovidés, quoiqu'elle puisse mordre d'autres types d'animaux. Les mâles eux ne consomment que du nectar. C'est un grand taon, long de 25 à 30 mm, au corps gris brun, aux grands yeux composés porteurs de bandes horizontales, au vol bruyant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tabanus bovinus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.97%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 18 variable positions, in barcode order

50Cmostly conserved

58Cmostly conserved

124Cmostly conserved

142Tmostly conserved

283Tmostly conserved

343Amostly conserved

364Cmostly conserved

493Amostly conserved

499Cmostly conserved

514Tmostly conserved

553Tmostly conserved

595Cmostly conserved

604Tmostly conserved

616Cmostly conserved

622Amostly conserved

634Tmostly conserved

641Cmostly conserved

646Tvariable

AACATTATATTTTATCTTTGGAGCATGAGCCGGAATAATTGGTACTTCACTAAGTATCTTAATTCGAGCTGAATTAGGACATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tabanus chrysurussame genus2.6%Tabanus novaescotiaesame genus2.6%Tabanus sudeticussame genus2.6%Tabanus calenssame genus3.7%Tabanus spodopterussame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Tabanus bovinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 432 records

Wild obs. + sensor1 019

Museum / vouchered411

Other2

Origin

Native1

Range

Area of Occupancy AOO3 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 385≤1 km 201≤10 km 254>10 km 3

843 georeferenced · 176 without coordinates

Open the mapobservation + sensor1 019

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 60≤1 km 89≤10 km 180>10 km 1

330 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	142
Helsinki, FI	99
University of Tokyo, Department of Zoologylocation not on record	34
ZMAAlocation not on record	29
SLU Artdatabankenlocation not on record	23
Gothenburg, SE	8
Tilburg, NL	6
Muséum d'histoire naturelle de Marseillelocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
ZSMlocation not on record	4
BioFokuslocation not on record	4
Stockholm, SE	3
Tromsø, NO	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
CBDClocation not on record	2
Tartu, EE	2
Banyoles, ES	1
Paris, FR	1
Uniwersytet Łódzkilocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Mississippi State, US	1
SBPlocation not on record	1
neflocation not on record	1
Philadelphia, US	1

24 institutions · 378 of 411 vouchered records shown · 33 without an institution code

09Environmental DNA1 detections

Where the DNA of Tabanus bovinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)19.9 °C

Min temp (night)10.6 °C

Precipitation173 mm/mo

Air humidity62.3 %

Moisture balance52.7 mm/mo

Vapour deficit682 Pa

Wind speed3.10 m/s

Cloud cover38.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tabanus bovinus

At a glance

Sources6 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 432 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 432 records