Systomus spilurus — The Life Data

Animalia/Chordata/Cypriniformes/Cyprinidae/Systomus

At a glance

Occurrence records3

Data sources6

Biological traits4

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Systomus spilurus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF3 records

DNA & barcodingBOLD3 specimens

01Narrative

Systomus spilurus is a species of cyprinid fish endemic to Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length2.8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Systomus spilurus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BIN1

Most divergent pair0.47%

Where individuals differ — all 3 variable positions, in barcode order

18Cvariable

64Tvariable

630Gvariable

ATTGGCACCCTATATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCTTAAGCCTTTTTATCCGAGCTGAACTAAGCCAACCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Systomus orphoidessame genus5.5%Systomus rubripinnissame genus6.0%Leptobarbus melanopterussame family6.6%Enteromius chiumbeensissame family7.7%Enteromius prionacanthussame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3