Systomus rubripinnis

(Valenciennes, 1842) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Systomus

At a glance

Occurrence records601

Data sources8

Biological traits5

DNA specimens3

eDNA detections5

Sources8 archives

Databases and archives Systomus rubripinnis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility601 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF601 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD3 specimens

01Narrative

The Javaen barb (Systomus rubripinnis), is a species of cyprinid fish native to Southeast Asia. It can reach a length of 25 cm SL and is of minor importance to local commercial fisheries. ID plate according to Bleeker

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability20.5

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Systomus rubripinnis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 2 variable positions, in barcode order

241Gvariable

482Cvariable

AAGCCTTCTTATCCGAGCTGAACTAAGCCAACCCGGATCGCTATTAGGTGATGACCAAATTTATAACGTTATTGTTACTGCCCACGCCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Systomus orphoidessame genus3.3%Systomus saranasame genus5.3%Leptobarbus melanopterussame family6.0%Systomus spilurussame genus6.0%Enteromius chiumbeensissame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type601 records

Wild obs. + sensor548

Museum / vouchered49

Other4

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 432≤1 km 25≤10 km 3>10 km 14

474 georeferenced · 74 without coordinates

Open the mapobservation + sensor548

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 49 records without

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	44
Washington, US	3
Kagoshima University Museumlocation not on record	1
South Kensington, GB	1

4 institutions · 49 of 49 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Systomus rubripinnis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 27.4–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C 31.0–33.2

Min temp (night)23.6 °C 22.1–23.9

Precipitation137 mm/mo 58.7–270

Air humidity59.8 % 54.3–65.7

Moisture balance-8.90 mm/mo -73.4–121

Vapour deficit1,523 Pa 1,261–1,713

Wind speed2.20 m/s 1.50–2.40

Cloud cover38.6 % 38.6–63.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)