Syngamia florella

Cramer, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Syngamia

At a glance

Occurrence records5 356

Data sources7

Biological traits0

DNA specimens37

eDNA detections2

Sources7 archives

Databases and archives Syngamia florella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 356 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 356 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD37 specimens

01Narrative

Syngamia florella, the orange-spotted flower moth or red waisted florella moth, is a moth of the family Crambidae. It was described by Caspar Stoll in 1781. It is found from South Carolina to Florida and from Arkansas to Texas, south to the West Indies and through Mexico to Argentina. It is also found on Bermuda. The wingspan is about 15 mm. Adults are dark brown with yellow patches on both the forewings and hindwings. They are on wing from July to December in most of the range, but have only been recorded from September to December in Florida. The larvae feed on Borreria brachysepala, Spermacoce laevis and Spermacoce tetraquetra.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Syngamia florella has left across the world's sequence archives.

At a glance

DNA specimens37

BINs3

Marker genes1

eDNA detections2

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 70 variable positions, in barcode order

4Amostly conserved

22Amostly conserved

23Amostly conserved

31Amostly conserved

34Tmostly conserved

40Amostly conserved

43Amostly conserved

55Tmostly conserved

70Tmostly conserved

88Gvariable

103Tmostly conserved

106Cmostly conserved

118Tmostly conserved

139Amostly conserved

163Tmostly conserved

190Tmostly conserved

202Amostly conserved

220Tmostly conserved

223Amostly conserved

232Tmostly conserved

235Cmostly conserved

238Tmostly conserved

256Amostly conserved

263Tmostly conserved

265Amostly conserved

266Cmostly conserved

268Tmostly conserved

274Tmostly conserved

277Amostly conserved

283Tmostly conserved

298Amostly conserved

307Tmostly conserved

349Cmostly conserved

364Tmostly conserved

373Amostly conserved

376Amostly conserved

379Amostly conserved

412Amostly conserved

421Tmostly conserved

424Tmostly conserved

428Tmostly conserved

436Amostly conserved

445Tmostly conserved

451Tmostly conserved

478Amostly conserved

479Cmostly conserved

481Tmostly conserved

484Cvariable

499Amostly conserved

508Gmostly conserved

517Amostly conserved

520Amostly conserved

526Tmostly conserved

542Cmostly conserved

544Tmostly conserved

547Gmostly conserved

548Tmostly conserved

550Amostly conserved

553Amostly conserved

556Tmostly conserved

562Amostly conserved

565Tmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

607Amostly conserved

616Tmostly conserved

625Tmostly conserved

634Cmostly conserved

640Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes8

BINs3

Most divergent pair10.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lygropia tripunctatasame family6.5%Glyphodes stolalissame family6.5%Bradina geminalissame family6.8%Herpetogramma rudissame family7.0%Conchylodes concinnalissame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 356 records

Wild obs. + sensor4 827

Museum / vouchered529

Range

Area of Occupancy AOO12 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 433≤1 km 776≤10 km 254>10 km 395

3 858 georeferenced · 969 without coordinates

Open the mapobservation + sensor4 827

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 12≤1 km 5

17 georeferenced · 512 without coordinates

Open the institutions mapphysical evidence529

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	464
University of Central Floridalocation not on record	21
The University of the West Indies, Trinidad and Tobagolocation not on record	12
NHMOlocation not on record	10
Universidad de Sucre (UniSucre)location not on record	9
Tapachula, MX	4
RMNHlocation not on record	3
Ciudad de México, MX	2
OSUClocation not on record	2
San Francisco, US	1

10 institutions · 528 of 529 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Syngamia florella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Syngamia florella

At a glance

Sources7 archives

At a glance

Record type5 356 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 356 records