Spialia doris

(Walker, 1870) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Spialia

At a glance

Occurrence records107

Data sources8

Biological traits0

DNA specimens13

eDNA detections15

Sources8 archives

Databases and archives Spialia doris's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF107 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceNCBI≈50 Mbp

01Narrative

Spialia doris, the Aden skipper or desert grizzled skipper, is a butterfly of the family Hesperiidae. It is found in Morocco, Egypt, Saudi Arabia, United Arab Emirates, Somalia and India. In the Atlas mountains it is found at heights of 400 to 1,750 meters above sea-level. The wingspan is 22–26 mm. Adults are on wing from March to May and from August to September in two generations. Spialia doris (Dry season form) from United Arab Emirates The larvae feed on Convolvolus lanatus, Convolvolus caputmedusae, Convolvolus trabutianus and Ipomoea species.Afrotropical Butterflies: Hesperiidae - Subfamily Pyrginae

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spialia doris has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

73Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTTTACTTATTCGATCTGAACTAGGTACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes3

BIN1

Most divergent pair0.30%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Spialia phlomidissame genus7.9%Spialia sertoriussame genus8.5%Carcharodus lavatheraesame family9.0%Carcharodus flocciferasame family9.3%Gorgopas trochilussame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Spialia doris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈49 977 035 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Spialia doris0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type107 records

Wild obs. + sensor95

Museum / vouchered10

Other2

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 13≤1 km 7≤10 km 3

23 georeferenced · 72 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	3
Helsinki, FI	1
Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lablocation not on record	1

3 institutions · 5 of 10 vouchered records shown · 5 without an institution code

09Environmental DNA15 detections

Where the DNA of Spialia doris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.4–17.7

Seasonal swing summer↔winter17.5 °C

Max temp (day)19.0 °C 16.4–23.5

Min temp (night)6.10 °C 5.00–11.6

Precipitation20.4 mm/mo 8.60–80.1

Air humidity49.8 % 46.2–53.4

Moisture balance-83.9 mm/mo -143–-29.3

Vapour deficit796 Pa 637–1,048

Wind speed3.50 m/s 2.80–4.00

Cloud cover26.3 % 24.0–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)