Spialia phlomidis

(Herrich-Schäffer, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Spialia

At a glance

Occurrence records355

Data sources9

Biological traits0

DNA specimens25

eDNA detections23

Sources9 archives

Databases and archives Spialia phlomidis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility355 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF355 records

Environmental DNA1 datasets · 6 countries23 detections

DNA & barcodingBOLD25 specimens

Genome at a glanceGoaT · NCBI≈282 Mbp

01Narrative

Spialia phlomidis, the Persian skipper, is a butterfly of the family Hesperiidae. It is found in Albania, North Macedonia, Greece, southern Russia, Asia Minor and Iran. The habitat consists of dry steppe habitats at moderate elevations.Russian Insects The length of the forewings is 14–15 mm. Adults are on wing from June to July in one generation. The larvae feed on Convolvulus libanotica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spialia phlomidis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes2

eDNA detections23

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

139Cmostly conserved

217Amostly conserved

253Amostly conserved

343Cmostly conserved

463Tmostly conserved

490Tmostly conserved

500Cmostly conserved

562Tmostly conserved

578Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGAACATCTTTAAGCTTATTAATTCGATCTGAATTAGGTACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BINs2

Most divergent pair9.6%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Carcharodus flocciferasame family8.4%Blenina lichenosasame order9.1%Euglyphis mariasame order9.1%Heliconius hecalesame order9.4%Heliconius zuleikasame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Spialia phlomidis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈282 135 077 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Spialia phlomidis0.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 311×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness20% BUSCO

08Occurrence & distribution

Record type355 records

Wild obs. + sensor210

Museum / vouchered137

Cultivated / captive6

Other2

Range

Area of Occupancy AOO740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 57≤1 km 25≤10 km 54

136 georeferenced · 74 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 115>10 km 6

121 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence137

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	6
Cambridge, US	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
NMOKlocation not on record	2
Nijmegen, NL	1
Tartu, EE	1
Natural History Museum Rotterdamlocation not on record	1

7 institutions · 17 of 137 vouchered records shown · 120 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Spialia phlomidis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 16.2–24.7

Seasonal swing summer↔winter20.5 °C

Max temp (day)22.9 °C 20.6–31.4

Min temp (night)11.0 °C 8.20–18.0

Precipitation25.9 mm/mo 0.4–85.7

Air humidity51.3 % 48.4–57.7

Moisture balance-141 mm/mo -197–-44.7

Vapour deficit972 Pa 781–1,604

Wind speed3.50 m/s 2.30–4.60

Cloud cover25.1 % 6.20–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)