Spialia colotes

(Druce, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Spialia

At a glance

Occurrence records16

Data sources10

Biological traits0

DNA specimens5

eDNA detections7

Sources10 archives

Databases and archives Spialia colotes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · NCBI≈256 Mbp

01Narrative

Spialia colotes, the Bushveld sandman, is a butterfly of the family Hesperiidae. The species was first described by Herbert Druce in 1875. It is found in Angola, Botswana and from South Africa to Ethiopia and south-western Arabia. These skippers are dark brown with white spots on both sides of the wings. The wingspan is from 21–28 mm. The flight period is from December to May, with a single brood. The larvae feed on Hibiscus fuscus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spialia colotes has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

37Gvariable

46Tmostly conserved

47Tmostly conserved

52Tmostly conserved

67Tmostly conserved

70Amostly conserved

71Cmostly conserved

78Tmostly conserved

79Tmostly conserved

82Cmostly conserved

85Tmostly conserved

97Tmostly conserved

118Amostly conserved

154Cmostly conserved

166Tmostly conserved

190Cmostly conserved

217Cvariable

232Cmostly conserved

235Cmostly conserved

256Cmostly conserved

262Cmostly conserved

268Cmostly conserved

271Cmostly conserved

275Cmostly conserved

292Amostly conserved

322Gmostly conserved

343Cmostly conserved

344Tmostly conserved

350Gmostly conserved

352Tmostly conserved

361Tmostly conserved

382Tmostly conserved

403Tmostly conserved

418Amostly conserved

424Cmostly conserved

439Cmostly conserved

457Tmostly conserved

460Cmostly conserved

474Gmostly conserved

475Tmostly conserved

496Tmostly conserved

530Tmostly conserved

544Amostly conserved

565Amostly conserved

583Amostly conserved

598Cmostly conserved

613Tmostly conserved

619Gmostly conserved

625Gmostly conserved

637Cmostly conserved

643Cmostly conserved

TTTATATTTTATTTTTGGTATTTGATCAGGAATAGTGGGAACTTCTTTAAGTTTACTTATTCGTTCTGAACTAGGAATTCCCGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes4

BINs2

Most divergent pair7.3%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Spialia dromussame genus9.8%Carcharodus lavatheraesame family10.1%Spialia sertoriussame genus11.0%Staphylus tucumanussame family11.3%Lacinipolia delongisame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Spialia colotes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈256 127 795 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Spialia colotes0.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness33.5% BUSCO

08Occurrence & distribution

Record type16 records

Museum / vouchered16

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence16

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	10
New Haven, US	2
Cambridge, US	2
National Museums of Kenyalocation not on record	2

4 institutions · 16 of 16 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Spialia colotes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

2. Savanna | 2.1. Dry SavannaSabie/Crocodile Thorn Thicket

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 20.3–28.9

Seasonal swing summer↔winter8.70 °C

Max temp (day)29.6 °C 25.7–34.1

Min temp (night)20.0 °C 14.7–23.1

Precipitation77.8 mm/mo 26.0–84.4

Air humidity59.1 % 50.1–59.6

Moisture balance-67.5 mm/mo -117–-62.5

Vapour deficit1,286 Pa 1,056–1,914

Wind speed2.90 m/s 2.80–3.40

Cloud cover36.3 % 13.2–36.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)