Spialia dromus

(Plötz, 1884) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Spialia

At a glance

Occurrence records755

Data sources9

Biological traits0

DNA specimens7

eDNA detections0

Sources9 archives

Databases and archives Spialia dromus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility755 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF755 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈144 Mbp

01Narrative

Spialia dromus, the forest sandman, dromus grizzled skipper or large grizzled skipper, is a butterfly of the family Hesperiidae. It is found in tropical Africa. In South Africa it is found along the eastern Cape coast to KwaZulu-Natal into Eswatini. It is also present in Mpumalanga and the Limpopo Province into northern Gauteng and the extreme north-west of the North West Province. The wingspan is 23–29 mm for males and 29–32 mm for females. Adults are on wing year-round but are more common in warmer months. The larvae feed on Triumfetta tomentosa, Triumfetta rhomboidea, Melhania and Waltheria species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spialia dromus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BIN1

Most divergent pair2.1%

Where individuals differ — all 14 variable positions, in barcode order

28Avariable

82Cvariable

127Cvariable

139Cvariable

197Tvariable

334Tvariable

370Gvariable

385Tvariable

428Cvariable

433Avariable

500Tvariable

539Cvariable

607Cvariable

646Tvariable

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTTTACTTATTCGATCTGAATTAGGTACCCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Carcharodus flocciferasame family7.3%Carcharodus lavatheraesame family7.9%Staphylus musculussame family8.5%Nisoniades macariussame family8.5%Nannoparce poeyisame order9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2Wnt1

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Spialia dromus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈143 815 812 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Spialia dromus0.14 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness2.5% BUSCO

08Occurrence & distribution

Record type755 records

Wild obs. + sensor309

Museum / vouchered432

Other14

Range

Area of Occupancy AOO1 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 47≤1 km 28≤10 km 8

83 georeferenced · 226 without coordinates

Open the mapobservation + sensor309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 2≤10 km 9>10 km 10

21 georeferenced · 411 without coordinates

Open the institutions mapphysical evidence432

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	121
Teylers Museumlocation not on record	113
Durban Natural Science Museumlocation not on record	65
National Museum of Tanzanialocation not on record	29
Sydney, AU	22
Cambridge, US	18
DNSMlocation not on record	13
Uniwersytet Jagiellońskilocation not on record	11
KwaZulu-Natal Museumlocation not on record	8
Iziko South African Museumlocation not on record	7
Cape Town, ZA	6
Northern Michigan Universitylocation not on record	5
MZLUlocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
Helsinki, FI	1

15 institutions · 423 of 432 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)