Sphingomorpha chlorea

Cramer, 1777 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Sphingomorpha

At a glance

Occurrence records2 730

Data sources6

Biological traits0

DNA specimens156

eDNA detections208

Sources6 archives

Databases and archives Sphingomorpha chlorea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI208 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics156 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 730 records

Environmental DNA1 datasets · 10 countries208 detections

DNA & barcodingBOLD156 specimens

01Narrative

Sphingomorpha chlorea, the sundowner moth, is a species of moth in the family Erebidae that is native to Africa and southern Asia. The species was first described by Pieter Cramer in 1777. It is a fruit-piercing moth and a notorious pest in orchards. The fruit is pierced while performing a vertical and rhythmic movement of the head.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding156 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphingomorpha chlorea has left across the world's sequence archives.

At a glance

DNA specimens156

BINs3

Marker genes2

eDNA detections208

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus153 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

167Gmostly conserved

227Gmostly conserved

CTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCAGAACTAGGAAATCCTGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes12

BINs3

Most divergent pair4.1%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eublemma roseasame family6.7%Gondysia similissame family6.9%Erebus macropssame family7.0%Achaea catellasame family7.0%Tripudia balteatasame order7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 730 records

Wild obs. + sensor2 593

Museum / vouchered137

Range

Area of Occupancy AOO5 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 263≤1 km 325≤10 km 118>10 km 94

1 800 georeferenced · 793 without coordinates

Open the mapobservation + sensor2 593

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 9≤1 km 9≤10 km 27>10 km 8

53 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	33
New Haven, US	29
National Museums of Kenyalocation not on record	24
Muséum d'histoire naturelle de Marseillelocation not on record	11
Tartu, EE	8
Natural History Museum Rotterdamlocation not on record	7
ZSMlocation not on record	6
Helsinki, FI	2
Cornell University Insect Collectionlocation not on record	1

9 institutions · 121 of 137 vouchered records shown · 15 without an institution code

09Environmental DNA208 detections

Where the DNA of Sphingomorpha chlorea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found208

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 208 detections have coordinates

Open the map10 countries0

Mopane/Bushwillow WoodlandsMixed habitatLembomboÂ Mountain Bushveld5. Wetlands (inland) | 5.16. Permanent Salin…4. Native Grassland | 4.6. Subtropical/Tropi…1. Forest & Woodland | 1.5. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 19.2–26.4

Seasonal swing summer↔winter2.90 °C

Max temp (day)27.2 °C 24.4–30.9

Min temp (night)16.0 °C 13.7–21.2

Precipitation77.4 mm/mo 34.5–140

Air humidity56.5 % 53.6–60.5

Moisture balance-74.0 mm/mo -105–-12.7

Vapour deficit1,176 Pa 962–1,471

Wind speed2.60 m/s 2.10–4.20

Cloud cover34.0 % 20.0–70.3

CHELSA 1981–2010, ~9 km grid, at location & month of 204 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphingomorpha chlorea

At a glance

Sources6 archives

At a glance

Record type2 730 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 730 records