Sphaerophoria sulphuripes

(Thomson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphaerophoria

At a glance

Occurrence records2 428

Data sources7

Biological traits0

DNA specimens123

eDNA detections1

Sources7 archives

Databases and archives Sphaerophoria sulphuripes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 428 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics123 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 428 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD123 specimens

01Narrative

Sphaerophoria sulphuripes, the forked globetail, is a species of syrphid flies in the family Syrphidae native to Western North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding123 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaerophoria sulphuripes has left across the world's sequence archives.

At a glance

DNA specimens123

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus121 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

59Cvariable

68Gvariable

69Cvariable

79Avariable

106Tmostly conserved

154Cvariable

212Cvariable

235Tvariable

238Tvariable

278Tvariable

346Tvariable

355Tvariable

370Tvariable

406Cvariable

451Tvariable

562Tvariable

568Tvariable

604Tvariable

616Tvariable

646Tvariable

AACATTATATTTTCTATTTGGAGCTTGAGCTGGAATAGTAGGAACTTCTTTAAGTATTCTAATTCGTGCAGAACTTGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes16

BIN1

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphaerophoria rueppelliisame genus2.0%Sphaerophoria brevipilosasame genus2.3%Sphaerophoria asymmetricasame genus2.6%Sphaerophoria bankowskaesame genus2.6%Sphaerophoria infuscatasame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 428 records

Wild obs. + sensor1 991

Museum / vouchered437

Origin

Native137

Range

Area of Occupancy AOO5 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 962≤1 km 351≤10 km 82>10 km 197

1 592 georeferenced · 399 without coordinates

Open the mapobservation + sensor1 991

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 110≤1 km 117≤10 km 17

244 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	137
Santa Cruz, US	130
Essig Museum of Entomologylocation not on record	111
Oregon State Arthropod Collectionlocation not on record	30
San Francisco, US	6
Washington, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Royal Saskatchewan Museumlocation not on record	2
US	2
CUlocation not on record	1
US	1

12 institutions · 431 of 437 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Sphaerophoria sulphuripes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–14.8

Seasonal swing summer↔winter4.80 °C

Max temp (day)17.5 °C

Min temp (night)13.0 °C

Precipitation2.40 mm/mo

Air humidity75.6 %

Moisture balance-124 mm/mo

Vapour deficit409 Pa

Wind speed3.70 m/s

Cloud cover16.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphaerophoria sulphuripes

At a glance

Sources7 archives

At a glance

Record type2 428 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 428 records