Sphaerophoria rueppellii

(Wiedemann, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphaerophoria

At a glance

Occurrence records2 677

Data sources8

Biological traits2

DNA specimens29

eDNA detections2

Sources8 archives

Databases and archives Sphaerophoria rueppellii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 677 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 677 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD29 specimens

Genome at a glanceGoaT · TreeOfSex≈566 Mbp

01Narrative

Sphaerophoria rueppellii is a European species of hoverfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaerophoria rueppellii has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes2

eDNA detections2

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

634Cmostly conserved

AACATTATATTTTCTATTTGGAGCTTGAGCTGGAATAGTAGGAACATCTTTAAGTATTTTAATTCGTATAGAACTTGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes4

BIN1

Most divergent pair0.61%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphaerophoria brevipilosasame genus1.5%Sphaerophoria asymmetricasame genus1.8%Sphaerophoria bankowskaesame genus1.8%Sphaerophoria infuscatasame genus1.8%Sphaerophoria indianasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Sphaerophoria rueppellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈566 037 386 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sphaerophoria rueppellii0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 84×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J. W. and J. M. Brink (1964). "Chromosomes of Syrphidae." Chromosoma 15(5): 579-590. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.8% BUSCO

08Occurrence & distribution

Record type2 677 records

Wild obs. + sensor2 088

Museum / vouchered589

Origin

Native66

Range

Area of Occupancy AOO5 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 487≤1 km 328≤10 km 932>10 km 29

1 776 georeferenced · 312 without coordinates

Open the mapobservation + sensor2 088

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 38≤1 km 148≤10 km 41>10 km 11

238 georeferenced · 351 without coordinates

Open the institutions mapphysical evidence589

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
IMEDEAlocation not on record	137
CIBIOlocation not on record	133
University of Kinshasalocation not on record	130
Gothenburg, SE	38
Philadelphia, US	18
NCMGlocation not on record	16
KwaZulu-Natal Museumlocation not on record	10
Natural History Museum Rotterdamlocation not on record	10
MZLUlocation not on record	9
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
Helsinki, FI	8
Tilburg, NL	8
SLU Artdatabankenlocation not on record	7
Sevilla, ES	5
CBDClocation not on record	4
ZSMlocation not on record	2
Trondheim, NO	2
DFFW2016location not on record	2
DFFW1981location not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Hungarian Natural History Museumlocation not on record	2
DFlocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
International Centre of Insect Physiology and Ecologylocation not on record	1
Copenhagen, DK	1
NTNU-VMlocation not on record	1
NMOKlocation not on record	1
South Kensington, GB	1
neflocation not on record	1
UFPRlocation not on record	1

31 institutions · 564 of 589 vouchered records shown · 25 without an institution code

09Environmental DNA2 detections

Where the DNA of Sphaerophoria rueppellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter1.70 °C

Max temp (day)22.1 °C

Min temp (night)11.8 °C

Precipitation101 mm/mo

Air humidity57.8 %

Moisture balance-33.7 mm/mo

Vapour deficit816 Pa

Wind speed3.00 m/s

Cloud cover27.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphaerophoria rueppellii

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 677 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 677 records