Sonia canadana

McDunnough, 1925 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Sonia

At a glance

Occurrence records318

Data sources8

Biological traits0

DNA specimens75

eDNA detections94

Sources8 archives

Databases and archives Sonia canadana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility318 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI94 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF318 records

Environmental DNA1 datasets · 2 countries94 detections

DNA & barcodingBOLD75 specimens

01Narrative

Sonia canadana, the Canadian sonium, is a species of tortricid moth in the family Tortricidae. The MONA or Hodges number for Sonia canadana is 3219.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonia canadana has left across the world's sequence archives.

At a glance

DNA specimens75

BINs2

Marker genes1

eDNA detections94

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus72 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

34Amostly conserved

40Gmostly conserved

59Tvariable

76Gmostly conserved

214Avariable

274Cmostly conserved

367Tvariable

412Gmostly conserved

478Tvariable

484Tmostly conserved

556Gmostly conserved

562Cvariable

574Tvariable

TACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTGGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes22

BINs2

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sonia vovanasame genus6.1%Eucosma rupestranasame family6.8%Sonia paraplesianasame genus6.8%Sonia constrictanasame genus7.0%Pelochrista morrisonisame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type318 records

Wild obs. + sensor214

Museum / vouchered104

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 151≤1 km 33≤10 km 4>10 km 3

191 georeferenced · 23 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 1≤1 km 1≤10 km 6>10 km 9

17 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	27
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
East Lansing, US	15
St. Paul, US	8
Mississippi State, US	1
OSUClocation not on record	1

6 institutions · 75 of 104 vouchered records shown · 29 without an institution code

09Environmental DNA94 detections

Where the DNA of Sonia canadana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found94

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 94 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forestMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 18.0–26.0

Seasonal swing summer↔winter26.2 °C

Max temp (day)25.5 °C 22.3–31.5

Min temp (night)16.1 °C 14.2–22.0

Precipitation95.1 mm/mo 75.9–115

Air humidity58.6 % 57.5–61.1

Moisture balance-59.1 mm/mo -86.1–-23.4

Vapour deficit1,016 Pa 842–1,379

Wind speed3.20 m/s 2.40–4.10

Cloud cover39.5 % 30.8–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)