Sonia paraplesiana

Blanchard, 1979 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Sonia

At a glance

Occurrence records248

Data sources8

Biological traits0

DNA specimens6

eDNA detections1

Sources8 archives

Databases and archives Sonia paraplesiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF248 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Sonia paraplesiana, the Hebrew sonia moth, is a species of moth of the family Tortricidae. It is found in the United States, where it has been recorded from Alabama, Florida, Georgia, Illinois, Kentucky, Maryland, North Carolina, Ohio, South Carolina, Tennessee and West Virginia. The wingspan is 14 mm. Adults are on wing from March to October.mothphotographersgroup

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonia paraplesiana has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

1Amostly conserved

31Cvariable

40Amostly conserved

43Amostly conserved

49Tvariable

52Cvariable

55Tvariable

70Avariable

76Gmostly conserved

82Tmostly conserved

85Tmostly conserved

88Tmostly conserved

112Tmostly conserved

118Tmostly conserved

127Tmostly conserved

130Tmostly conserved

133Tmostly conserved

139Tmostly conserved

154Tmostly conserved

163Avariable

169Tmostly conserved

178Tmostly conserved

202Amostly conserved

223Amostly conserved

235Cmostly conserved

238Cmostly conserved

241Tmostly conserved

250Tvariable

253Amostly conserved

256Cvariable

266Tmostly conserved

280Cvariable

289Avariable

295Tvariable

307Tmostly conserved

337Tmostly conserved

340Tvariable

349Amostly conserved

364Cmostly conserved

370Amostly conserved

379Cvariable

382Tmostly conserved

386Tmostly conserved

401Tvariable

403Avariable

412Amostly conserved

415Amostly conserved

421Amostly conserved

433Amostly conserved

439Avariable

445Tmostly conserved

472Cmostly conserved

478Tmostly conserved

484Amostly conserved

499Cvariable

500Cvariable

508Tmostly conserved

514Amostly conserved

517Cvariable

523Tvariable

529Tmostly conserved

536Tmostly conserved

538Amostly conserved

542Cvariable

547Cvariable

553Amostly conserved

556Amostly conserved

562Avariable

565Tvariable

578Cmostly conserved

580Tmostly conserved

592Amostly conserved

604Amostly conserved

622Cmostly conserved

625Amostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACTTCTCTCAGTTTATTAATTCGAGCAGAATTGGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.7%

Haplotypes3

BINs2

Most divergent pair7.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sonia vovanasame genus4.7%Pelochrista conspiciendanasame family6.3%Pelochrista dorsisignatanasame family6.4%Pelochrista cataclystianasame family6.5%Eucosma clarescenssame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor110

Museum / vouchered138

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 44≤1 km 22≤10 km 9>10 km 9

84 georeferenced · 26 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 12≤10 km 17>10 km 4

33 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	60
Cornell University Insect Collectionlocation not on record	56
St. Paul, US	16
East Lansing, US	3
CUlocation not on record	2
Washington, US	1

6 institutions · 138 of 138 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Sonia paraplesiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)