Somula decora

Macquart, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Somula

At a glance

Occurrence records688

Data sources9

Biological traits0

DNA specimens15

eDNA detections15

Sources9 archives

Databases and archives Somula decora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility688 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF688 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Somula decora (Macquart, 1847 ) , the Spotted Wood Fly , is an uncommon species of syrphid fly observed in central to eastern North America. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers, from which they get both enegy-giving nectar and protein rich pollen. The larvae live in decaying wood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Somula decora has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

43Gmostly conserved

79Amostly conserved

82Cmostly conserved

163Tmostly conserved

166Amostly conserved

316Gmostly conserved

436Tmostly conserved

641Tmostly conserved

AACATTATATTTTTTATTTGGAACATGAGCTGGAATAGTAGGGACATCTTTAAGAATCTTAATTCGTGCAGAACTTGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes7

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Blera confusasame family5.6%Blera flukeisame family6.1%Blera eoasame family6.2%Blera nigrasame family6.3%Caliprobola speciosasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Somula decora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–122n range11median10mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J. W. and J. M. van Brink (1967). "Chromosomes of Syrphidae." Chromosoma 22(4): 417-455. ↗

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J. W. and J. M. Brink (1964). "Chromosomes of Syrphidae." Chromosoma 15(5): 579-590. ↗

08Occurrence & distribution

Record type688 records

Wild obs. + sensor508

Museum / vouchered180

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 247≤1 km 121≤10 km 28>10 km 43

439 georeferenced · 69 without coordinates

Open the mapobservation + sensor508

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 12≤1 km 37≤10 km 36>10 km 17

102 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Georgia Museum of Natural Historylocation not on record	43
Toronto, CA	28
OSUClocation not on record	26
University Park, US	22
Champaign, US	18
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
University of Guelphlocation not on record	11
Wuzhou, CN	2
Chicago, US	2
University of Nebraska State Museumlocation not on record	2
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Cambridge, US	1
University of Alberta Museums (UAM)location not on record	1
Cornell University Insect Collectionlocation not on record	1
Saint John, CA	1

16 institutions · 176 of 180 vouchered records shown · 4 without an institution code

09Environmental DNA15 detections

Where the DNA of Somula decora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 13.4–18.3

Seasonal swing summer↔winter27.0 °C

Max temp (day)22.2 °C 17.2–23.6

Min temp (night)13.4 °C 8.70–15.2

Precipitation89.8 mm/mo 83.5–107

Air humidity58.2 % 57.0–59.5

Moisture balance-46.5 mm/mo -61.2–-29.4

Vapour deficit848 Pa 667–888

Wind speed3.40 m/s 2.70–5.30

Cloud cover42.6 % 40.2–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)