Caliprobola speciosa

(Rossi, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Caliprobola

At a glance

Occurrence records1 203

Data sources7

Biological traits2

DNA specimens22

eDNA detections18

Sources7 archives

Databases and archives Caliprobola speciosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 203 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD22 specimens

01Narrative

Habitat.Bagni di Lucca, Italy Caliprobola speciosa is a Palearctic hoverfly. It is an ancient woodland bioindicator.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)saprophagous

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caliprobola speciosa has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

32Gmostly conserved

34Amostly conserved

47Tmostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

67Tmostly conserved

68Gmostly conserved

69Cmostly conserved

80Cmostly conserved

81Amostly conserved

86Gmostly conserved

89Gmostly conserved

90Cmostly conserved

92Cmostly conserved

97Tmostly conserved

101Gmostly conserved

106Cmostly conserved

127Tmostly conserved

130Tmostly conserved

143Gmostly conserved

154Cmostly conserved

163Amostly conserved

205Tmostly conserved

212Cmostly conserved

223Cmostly conserved

232Amostly conserved

242Amostly conserved

247Tmostly conserved

256Tmostly conserved

316Amostly conserved

514Cmostly conserved

601Tmostly conserved

628Gmostly conserved

629Gmostly conserved

AACATTATATTTTCTATTCGGAACGTGAGCTGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGTGCAGAACTTGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BIN1

Most divergent pair0.76%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Blera badiasame family5.6%Blera flukeisame family6.1%Somula decorasame family6.4%Blera armillatasame family6.7%Blera confusasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_081083 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 203 records

Wild obs. + sensor1 140

Museum / vouchered63

Range

Area of Occupancy AOO2 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 377≤1 km 142≤10 km 416>10 km 4

939 georeferenced · 201 without coordinates

Open the mapobservation + sensor1 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 2≤1 km 7≤10 km 2

11 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	17
Royal British Columbia Museumlocation not on record	7
ZSMlocation not on record	4
Helsinki, FI	3
Bavarian State Collection of Zoologylocation not on record	3
CIBIOlocation not on record	2
NHMOlocation not on record	2
Tilburg, NL	2
CBDClocation not on record	1
NMOKlocation not on record	1

10 institutions · 42 of 63 vouchered records shown · 20 without an institution code

09Environmental DNA18 detections

Where the DNA of Caliprobola speciosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

Along pathEichen-Buchen Mischwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.3 °C 6.40–15.5

Seasonal swing summer↔winter18.0 °C

Max temp (day)17.0 °C 10.5–19.8

Min temp (night)8.30 °C 3.50–10.2

Precipitation86.3 mm/mo 52.5–233

Air humidity63.8 % 58.1–67.3

Moisture balance-5.00 mm/mo -57.3–139

Vapour deficit519 Pa 401–743

Wind speed3.00 m/s 1.90–4.10

Cloud cover36.1 % 29.3–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caliprobola speciosa

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 203 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 203 records