Somniosus rostratus

(Risso, 1827) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Squaliformes/Somniosidae/Somniosus

At a glance

Occurrence records85

Data sources9

Biological traits7

DNA specimens17

eDNA detections12

Sources9 archives

Databases and archives Somniosus rostratus's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

OBISOcean Biodiversity Information System29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS85 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD17 specimens

01Narrative

The little sleeper shark (Somniosus rostratus) is a small sleeper shark of the family Somniosidae found in the northeast Atlantic, western Mediterranean, and western Pacific around New Zealand, at depths between 200 and 1,000 m. Its length is up to 1.43 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length143 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max1 330 m

Depth min200 m

Vulnerability85.8

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Somniosus rostratus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

124Tmostly conserved

586Amostly conserved

587Gmostly conserved

593Amostly conserved

595Tmostly conserved

596Cmostly conserved

597Tmostly conserved

598Cmostly conserved

599Tmostly conserved

602Cmostly conserved

603Amostly conserved

605Cmostly conserved

606Amostly conserved

607Cmostly conserved

608Cmostly conserved

610Amostly conserved

AGCCCTGAGTTTACTTATTCGAACAGAATTAAGCCAACCAGGAACACTCCTAGGAGATGATCAAATCTACAATGTTATTGTTACTGCTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes5

BIN1

Most divergent pair2.3%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Somniosus pacificussame genus3.0%Somniosus microcephalussame genus3.0%Squalus cubensissame order11.1%Squalus edmundsisame order11.1%Squalus mitsukuriisame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type85 records

Wild obs. + sensor46

Museum / vouchered33

Other6

Origin

Native27

Range

Area of Occupancy AOO140 km²

Depth

0–200 m sunlit0

200–1000 m twilight7

1–4 km midnight5

>4 km abyssal0

median 966.2 m · max 2 220 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 12≤10 km 27

39 georeferenced · 7 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 6>10 km 1

7 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
FishBaselocation not on record	4
ICM-CSIClocation not on record	2
IEO-COMA-CSIClocation not on record	1
Bergen, NO	1
ICATMARlocation not on record	1
National Natural History Collectionslocation not on record	1
	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
ICMlocation not on record	1

10 institutions · 18 of 33 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Somniosus rostratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 7.90–22.4

Seasonal swing summer↔winter15.8 °C

Max temp (day)17.0 °C 11.7–23.1

Min temp (night)9.30 °C 3.60–21.7

Precipitation57.7 mm/mo 22.7–93.7

Air humidity58.9 % 58.1–61.4

Moisture balance22.5 mm/mo

Vapour deficit662 Pa 437–1,047

Wind speed4.10 m/s

Cloud cover43.5 % 33.2–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)