Somniosus pacificus

Bigelow & Schroeder, 1944 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Squaliformes/Somniosidae/Somniosus

At a glance

Occurrence records7 325

Data sources10

Biological traits7

DNA specimens27

eDNA detections0

Sources10 archives

Databases and archives Somniosus pacificus's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 220 records↗

OBISOcean Biodiversity Information System4 105 records↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS7 325 records

DNA & barcodingBOLD27 specimens

01Narrative

Pacific sleeper shark carcasses The Pacific sleeper shark (Somniosus pacificus) is a sleeper shark of the family Somniosidae, found in the North Pacific on continental shelves and slopes in Arctic and temperate waters between latitudes 70°N and 22°N, from the surface to 2000 m deep. Records from southern oceans are likely misidentifications of relatives. Its length is up to 4.4 m, although it could possibly reach lengths in excess of 7 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length440 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max2 205 m

Depth min0 m

Vulnerability90

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Somniosus pacificus has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes11

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 4 variable positions, in barcode order

280Avariable

511Cmostly conserved

520Amostly conserved

550Tmostly conserved

CCTATATTTAATCTTTGGTGCCTGAGCAGGGATAGTAGGCACAGCCCTGAGTTTACTTATTCGAACAGAATTAAGCCAACCAGGAACACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Somniosus rostratussame genus3.0%Squalus hemipinnissame order11.1%Cirrhigaleus australissame order11.3%Squalus cubensissame order11.3%Squalus mitsukuriisame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_022734 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type7 325 records

Wild obs. + sensor7 047

Museum / vouchered274

Other4

Origin

Native73

Range

Area of Occupancy AOO3 820 km²

Depth

0–200 m sunlit69

200–1000 m twilight13

1–4 km midnight7

>4 km abyssal0

median 0 m · max 1 207.5 m · 89 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤100 m 7≤1 km 4≤10 km 3>10 km 6 763

6 777 georeferenced · 270 without coordinates

Open the mapobservation + sensor7 047

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 4≤10 km 10>10 km 2

16 georeferenced · 258 without coordinates

Open the institutions mapphysical evidence274

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UWFClocation not on record	68
Los Angeles, US	4
University of California San Diegolocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
CASlocation not on record	3
Oregon State Universitylocation not on record	3
Wuzhou, CN	2
Barcelona, ES	1
Cambridge, US	1
Washington, US	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Edmonton, CA	1

12 institutions · 92 of 274 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Somniosus pacificus

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type7 325 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Record type7 325 records