Somena similis

(Moore) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Somena

At a glance

Occurrence records57

Data sources7

Biological traits0

DNA specimens8

eDNA detections9

Sources7 archives

Databases and archives Somena similis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Somena similis is a moth in the family Erebidae. It was described by Frederic Moore in 1860. It is found from India to Sundaland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Somena similis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

3Tmostly conserved

6Tmostly conserved

12Tmostly conserved

21Tmostly conserved

27Cvariable

30Tmostly conserved

45Gvariable

63Tmostly conserved

78Tmostly conserved

81Tmostly conserved

82Gmostly conserved

84Amostly conserved

111Tmostly conserved

117Amostly conserved

129Cvariable

168Cvariable

177Cvariable

186Cvariable

189Tmostly conserved

196Gmostly conserved

208Tmostly conserved

213Gmostly conserved

216Cmostly conserved

222Tmostly conserved

228Tmostly conserved

258Gvariable

267Cvariable

273Tmostly conserved

276Cmostly conserved

279Cvariable

283Tmostly conserved

312Tvariable

315Avariable

318Cvariable

333Cmostly conserved

336Tvariable

339Cmostly conserved

342Tmostly conserved

343Cvariable

349Gmostly conserved

351Tvariable

354Tmostly conserved

360Tvariable

363Cvariable

369Amostly conserved

375Tmostly conserved

378Amostly conserved

381Tvariable

396Tmostly conserved

417Cvariable

420Cvariable

444Tmostly conserved

465Amostly conserved

474Cmostly conserved

480Tmostly conserved

496Cmostly conserved

501Cvariable

532Tmostly conserved

538Cmostly conserved

546Tmostly conserved

552Tmostly conserved

558Cmostly conserved

561Amostly conserved

588Amostly conserved

591Cvariable

609Tmostly conserved

612Cmostly conserved

618Tmostly conserved

621Amostly conserved

624Amostly conserved

630Cmostly conserved

636Tmostly conserved

637Cmostly conserved

642Cvariable

CTTTATTTTATTTTTGGAATTTGAGCCGGTATAATTGGATCATCGTTAAGATTAATAATTCGTGCTGAATTAGGTAATCCTGGATCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.5%

Haplotypes3

BINs3

Most divergent pair7.8%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Somena scintillanssame genus6.2%Euproctis pulvereasame family6.2%Euproctis piperitasame family6.9%Kidokuga piperitasame family7.2%Euproctis fimbriatasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor57

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 13≤1 km 27≤10 km 1>10 km 5

46 georeferenced · 11 without coordinates

Open the mapobservation + sensor57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA9 detections

Where the DNA of Somena similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.0–25.7

Seasonal swing summer↔winter0.8 °C

Max temp (day)28.9 °C 28.5–29.5

Min temp (night)22.1 °C 21.3–22.5

Precipitation286 mm/mo 263–302

Air humidity70.8 % 66.9–71.7

Moisture balance177 mm/mo 138–182

Vapour deficit959 Pa 903–1,029

Wind speed0.9 m/s 0.8–1.20

Cloud cover69.4 % 38.0–74.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)