Somena scintillans

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Somena

At a glance

Occurrence records2 095

Data sources7

Biological traits0

DNA specimens33

eDNA detections63

Sources7 archives

Databases and archives Somena scintillans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 095 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 095 records

Environmental DNA1 datasets · 5 countries63 detections

DNA & barcodingBOLD33 specimens

01Narrative

Somena scintillans, the yellow tail tussock moth, is a moth in the family Erebidae described by Francis Walker in 1856.Wang, H.-S.; M. Wang & X.-L. Fan (2011). "Notes on the tribe Nygmiini (Lepidoptera: Erebidae: Lymantriinae) from Nanling National Nature Reserve, with description of a new species". Zootaxa. 2887: 57–68. It is found in northern India, Sri Lanka, Myanmar and the Andaman Islands. Though considered a minor pest, larva can sporadically be a serious pest.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Somena scintillans has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections63

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

29Gmostly conserved

30Gmostly conserved

34Avariable

79Tmostly conserved

136Tmostly conserved

178Avariable

197Gmostly conserved

217Cmostly conserved

265Gmostly conserved

343Cvariable

430Gvariable

467Cmostly conserved

547Cmostly conserved

643Cmostly conserved

ACTCTATTTTATTTTTGGAATCTGAGCAGGTATAATTGGCTCATCTTTAAGATTAATAATTCGTGCTGAATTAGGTAATCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes9

BIN1

Most divergent pair1.4%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Somena similissame genus6.2%Euproctis fimbriatasame family6.5%Euproctis piperitasame family6.9%Kidokuga piperitasame family7.2%Somena albasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_039764 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 095 records

Wild obs. + sensor1 639

Museum / vouchered456

Range

Area of Occupancy AOO2 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 114≤1 km 69≤10 km 13>10 km 5

201 georeferenced · 1 438 without coordinates

Open the mapobservation + sensor1 639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 456 records without

Open the institutions mapphysical evidence456

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
tesrilocation not on record	341
National Museum of Natural Sciencelocation not on record	98

2 institutions · 439 of 456 vouchered records shown · 17 without an institution code

09Environmental DNA63 detections

Where the DNA of Somena scintillans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…Subtropical forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 16.4–27.5

Seasonal swing summer↔winter13.2 °C

Max temp (day)25.2 °C 19.9–31.4

Min temp (night)17.2 °C 11.9–23.8

Precipitation271 mm/mo 39.5–455

Air humidity67.3 % 51.2–75.6

Moisture balance167 mm/mo -102–356

Vapour deficit831 Pa 587–1,301

Wind speed2.10 m/s 1.60–3.20

Cloud cover45.3 % 35.8–72.4

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Somena scintillans

At a glance

Sources7 archives

At a glance

Record type2 095 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 095 records