Siphona geniculata

(De Geer, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Siphona

At a glance

Occurrence records3 942

Data sources7

Biological traits0

DNA specimens68

eDNA detections458

Sources7 archives

Databases and archives Siphona geniculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI458 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 942 records

Environmental DNA4 datasets · 14 countries458 detections

DNA & barcodingBOLD68 specimens

01Narrative

Siphona geniculata is a Palearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphona geniculata has left across the world's sequence archives.

At a glance

DNA specimens68

BINs2

Marker genes1

eDNA detections458

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

46Gmostly conserved

68Avariable

160Avariable

601Cmostly conserved

604Tmostly conserved

610Tmostly conserved

619Cmostly conserved

634Tmostly conserved

653Tmostly conserved

TACTTTATATTTTATTTTCGGAGCTTGAGCTGGTATAGTAGGAACGTCTTTAAGAATATTAATTCGAACCGAATTAGGTCATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes9

BINs2

Most divergent pair9.3%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Siphona flavifronssame genus4.4%Siphona subarcticasame genus4.5%Siphona paludosasame genus6.5%Siphona collinisame genus7.6%Siphona cristatasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 942 records

Wild obs. + sensor3 370

Museum / vouchered530

Cultivated / captive28

Other14

Range

Area of Occupancy AOO6 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 2 212≤1 km 879≤10 km 219

3 310 georeferenced · 60 without coordinates

Open the mapobservation + sensor3 370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 268≤1 km 115≤10 km 53>10 km 5

441 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence530

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the mapnot free-living28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	206
NCMGlocation not on record	74
SLU Artdatabankenlocation not on record	35
Gothenburg, SE	27
Tromsø, NO	24
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
NHMOlocation not on record	20
CBDClocation not on record	11
DFFW2018location not on record	9
DFFW2016location not on record	9
Chicago, US	5
Provincia di Livornolocation not on record	5
Natural History Museum, Londonlocation not on record	4
Edmonton, CA	4
DFlocation not on record	4
Tilburg, NL	2
Natural History Museum Rotterdamlocation not on record	2
Finnish Museum of Natural History, Zoological Museumlocation not on record	2
DFFW1981location not on record	2
Norwegian Institute for Nature Researchlocation not on record	2
Tampere Museum of Natural Historylocation not on record	1
Copenhagen, DK	1
neflocation not on record	1
BioFokuslocation not on record	1
Metsähallituslocation not on record	1

25 institutions · 473 of 530 vouchered records shown · 57 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA458 detections

Where the DNA of Siphona geniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found458

Studies independent surveys4

Countries14

Verifiable raw sequence linked213

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 458 detections have coordinates

Open the map14 countries0

1. Forest & Woodland|1.1. Boreal Forest1. Forest, 1.4. Forest - Temperatecaraway field with flowering stripe located …1. Forest|1.4. Forest - TemperateUrbanForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.3–17.0

Seasonal swing summer↔winter17.5 °C

Max temp (day)18.2 °C 13.2–20.9

Min temp (night)10.7 °C 6.70–13.4

Precipitation88.3 mm/mo 55.4–112

Air humidity61.3 % 58.8–64.2

Moisture balance-16.9 mm/mo -54.2–46.9

Vapour deficit637 Pa 466–762

Wind speed3.60 m/s 2.40–5.20

Cloud cover47.5 % 36.7–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 448 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Siphona geniculata

At a glance

Sources7 archives

At a glance

Record type3 942 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 942 records