Siphona cristata

(Fabricius, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Siphona

At a glance

Occurrence records589

Data sources7

Biological traits0

DNA specimens42

eDNA detections35

Sources7 archives

Databases and archives Siphona cristata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF589 records

Environmental DNA1 datasets · 1 countries35 detections

DNA & barcodingBOLD42 specimens

01Narrative

Siphona cristata is a Palearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphona cristata has left across the world's sequence archives.

At a glance

DNA specimens42

BINs5

Marker genes1

eDNA detections35

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

13Tmostly conserved

14Amostly conserved

15Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

20Gmostly conserved

22Tmostly conserved

26Tmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

38Cmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

58Cmostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Tmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

106Tmostly conserved

121Amostly conserved

178Tmostly conserved

193Tmostly conserved

202Tmostly conserved

220Tmostly conserved

250Tmostly conserved

271Cmostly conserved

293Tmostly conserved

307Gmostly conserved

310Amostly conserved

313Tmostly conserved

316Gmostly conserved

318Cmostly conserved

337Amostly conserved

340Cmostly conserved

343Tmostly conserved

412Tmostly conserved

433Gmostly conserved

455Gmostly conserved

478Amostly conserved

490Tmostly conserved

514Tmostly conserved

518Gmostly conserved

523Tmostly conserved

542Tmostly conserved

601Tmostly conserved

616Cmostly conserved

631Tvariable

634Tmostly conserved

646Cmostly conserved

652Cmostly conserved

653Tmostly conserved

655Gmostly conserved

TACTTTATATTTTATTTTCGGTGCTTGAGCTGGTATACTAGGAACTTCTTTAAGAATCTTAATCCGAGCTGAATTAGGTCATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes8

BINs4

Most divergent pair8.8%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Siphona setosasame genus4.1%Siphona luteasame genus5.9%Siphona boreatasame genus5.9%Siphona paucisetasame genus6.1%Siphona futilissame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type589 records

Wild obs. + sensor509

Museum / vouchered78

Other2

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 385≤1 km 95≤10 km 29

509 georeferenced

Open the mapobservation + sensor509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 15≤1 km 15≤10 km 5

35 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
South Kensington, GB	10
SLU Artdatabankenlocation not on record	6
University of Tokyo, Department of Zoologylocation not on record	4
CBDClocation not on record	3
Gothenburg, SE	2
Tilburg, NL	2
DFFW2018location not on record	1
DFFW2016location not on record	1
NHMOlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1

11 institutions · 46 of 78 vouchered records shown · 32 without an institution code

09Environmental DNA35 detections

Where the DNA of Siphona cristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map1 country0

WetlandMixed habitatMixed Habitat5. Wetlands (inland)Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 15.0–19.7

Seasonal swing summer↔winter32.8 °C

Max temp (day)22.4 °C 19.6–24.9

Min temp (night)12.2 °C 10.0–15.7

Precipitation72.2 mm/mo 64.6–101

Air humidity57.3 % 55.4–59.6

Moisture balance-50.6 mm/mo -54.3–-2.10

Vapour deficit850 Pa 692–930

Wind speed2.30 m/s 2.10–3.40

Cloud cover41.1 % 37.1–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)