Silene vulgaris
(Moench) Garcke · speciesAt a glance
Occurrence records372 138
Data sources15
Biological traits68
DNA specimens120
eDNA detections324
Sources15 archives
Databases and archives Silene vulgaris's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility372 138 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI324 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics120 specimens↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources68 traits
Chemical compositionLOTUS · NPASS22 compounds
Occurrence & distributionGBIF372 138 records
Environmental DNA2 datasets · 14 countries324 detections
DNA & barcodingBOLD120 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.7 Gbp
01Narrative
Silene vulgaris flowers Silene vulgaris, the bladder campionBladder Campion, Prov. of Ontario or maidenstears, is a plant species of the genus Silene of the family Caryophyllaceae. It is native to Europe, where in some parts it is eaten, but is also widespread in North America, where it is a common wildflower in meadows, open woods, and fields.Bladder Campion, Prov. of Ontario
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length10 mm
Fruit length max11 mm
Fruit length min9 mm
Fruit width7 mm
Fruit width max7 mm
Fruit width min6 mm
Leaf length50 mm
Leaf length max85 mm
Leaf length min20 mm
Leaf mass63.76 mg
Leaf size201 mm²
⚠ sources differ — TRY: 201 mm² · LEDA: 1 180 mm² · GIFT: 1 180 mm²
Leaf width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 15 mm
Leaf width max25 mm
Leaf width min4 mm
Plant height0.385 m
⚠ sources differ — GIFT: 0.385 m · AusTraits: 1 m · LEDA: 0.26 m · TRY: 0.363 m
Plant height generative0.414 m
Plant height max1 m
Plant height min0.1 m
Seed length1.42 mm
⚠ sources differ — TRY: 1.42 mm · AusTraits: 1.25 mm · GIFT: 1.3 mm
Seed mass1.01 mg
⚠ sources differ — TRY: 1.01 mg · LEDA: 0.86 mg · GIFT: 0.877 mg
Seed mass max8.55 mg
Seed mass min0.17 mg
Life cycle & reproduction18
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourpink
Flower length max25 mm
Flower length min5 mm
Flowering endSep
Flowering startJul
Flowering timeyynnnnnnyyyy
Life formperennial
Life spanperennial
Lifespan years6.33 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
⚠ sources differ — LEDA: Chamaephyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Seed number99
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, forest
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate linear ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio15.46 g/g
Leaf c436 mg/g
Leaf dry-matter content (LDMC)158 mg/g
⚠ sources differ — TRY: 158 mg/g · LEDA: 166 mg/g
Leaf n30.14 mg/g
Leaf p3.62 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)23.59 mm²/mg
⚠ sources differ — TRY: 23.59 mm²/mg · LEDA: 18.85 mm²/mg · GIFT: 19.87 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationerect
03Chemical composition22 compounds
Compounds documented for Silene vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile4 classes
Ecdysteroids10
Oleanane triterpenoids8
Acyclic triterpenoids $ Polypodane triterpenoids1
Cyclofarnesane sesquiterpenoids1
Documented compounds22 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,3R,5R,9R,10R,13R,14S,17S)-17-[(2R,3R)-2,6-dihydroxy-6-methyl-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyheptan-2-yl]-1,2,3,14-tetrahydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one | present | LOTUS | |
| (2E)-3-Methyl-5-[(1R,3S)-2,2-dimethyl-3-hydroxy-6-methylenecyclohexyl]-2-pentene-1-ol | present | NPASS | |
| (2S,3R,5R,9R,10R,13R,14S,17S)-17-[(2R,3R)-2,6-Dihydroxy-6-methyl-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyheptan-2-yl]-2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one | present | LOTUS | |
| (2S,3R,5R,9R,10R,13R,14S,17S)-17-[(2R,3R)-2,6-dihydroxy-6-methyl-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyheptan-2-yl]-2,14-dihydroxy-10,13-dimethyl-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4S,5R)-3,5-dihydroxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxycarbonyl-4-formyl-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-carboxy-4-formyl-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-hydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| 2-Deoxy-20-hydroxyecdysone | present | LOTUS | |
| 3-Hydroxyolean-12-en-28-oic acid | present | LOTUS | |
| 4H-Pyran-4-one, 3-methyl-2-[[6-O-(1-oxo-3-phenyl-2-propenyl)-beta-D-glucopyranosyl]oxy]-, (E)- | present | LOTUS | |
| 6-[(8a-Carboxy-4-formyl-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl)oxy]-3-hydroxy-5-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-(3,4,5-trihydroxyoxan-2-yl)oxyoxane-2-carboxylic acid | present | LOTUS |
05DNA & barcoding120 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene vulgaris has left across the world's sequence archives.
At a glance
DNA specimens120
Marker genes9
eDNA detections324
Countries14
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P675 bp consensus16 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.
Where individuals differ — all 5 variable positions, in barcode order
10Avariable
13Cvariable
28Cmostly conserved
31Amostly conserved
112Cvariable
AGCACGCCCAGGCGATCAAATTCTTGGCGGAAATCATCAACTTTATAACGTTTTAATAACGGCTCACGCCTTTTTAATGATCTTTTTTAT …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)0.30%
Haplotypes4
BINs0
Most divergent pair0.74%
Other
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★trnL-F★ITS★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Silene vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 652 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Silene vulgaris1.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records12–482n range24median24mode148records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 24127×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database +19
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOON J.C. - 1980. Chromosome number reports LXIX.. Taxon , 29(5-6): 703-730.
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — MELZHEIMER V., DAMBOLDT J. - 1973. Zur Morphologie und Cytologie tetraploider Sippen von Silene vulgaris (Caryophyllaceae).. Willdenowia , 7(1): 83-100.
CCDB · ita-fl — DAMBOLDT J., PHITOS D. - 1968. Zur Cytotaxonomie einiger Arten der Gattung Silene L. (Caryophyllaceae).. Verh. Bot. Vereins Prov. Brandenburg , 105: 44-51.
CCDB · ita-fl — LOON J.C., JONG H. - 1978. IOPB chromosome number reports LIX.. Taxon , 27(1): 57-60.
CCDB · ita-fl — BALTISBERGER M., AESCHIMANN D. - 1988. Die chromosomenzahlen der Silene-Arten der Sektion Inflatae (Caryophyllaceae).. Ber. Geobot. Inst. E.T.H., Stiftung Rubel , 54: 51-60.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Leskovjanská A., 2007: [New records in Cirsium, Eupatorium, Lapsana, Leontodon, Medicago, Melilotus, Plantago, Salvia, Senecio, Silene, Sonchus, Tanacetum, Thlaspi, Trifolium, and Veronica], pp. 195, 251, 355, 359, 384, 387, 453, 518, 536, 549, 555, 568, 582, 592, 603. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — Die Chromosomenzahlen der Sektion Inflatae (Caryophyllaceae). Baltisberger, M. & D. Aeschimann.Ber. Geobot. Inst. E.T.H. Stiffung Rbel54: 51-60(1988).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1969
CCDB · fl-europaea — Griesinger, 1937
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · poland — Frey L. 1971. Chromosome numbers of several species of flowering plants in Poland. Fragm. Flor.\nGeobot. 17, 251-256.
CCDB · ipcn-api-dl — Zakirova, R. O. & I. I. Nafanailova. 1988. Chromosome numbers in members of some families of the Kazakhstan flora. Bot. Žhurn. (Moscow & Leningrad) 73: 452–453.
CCDB · ipcn-api-dl — Kovanda, M. 1983. Chromosome numbers in selected Angiosperms (1). Preslia 55: 193–205.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1995. Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(3): 85–88.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Shatokhina. 2006. Chromosome numbers of some plants of the Amur Region flora. Bot. Žhurn. (Moscow & Leningrad) 91(3): 487–490.
CCDB · ipcn-api-dl — Frey, L. 1971. Chromosome numbers of several species of flowering plants in Poland. Fragm. Florist. Geobot. 17: 251–256.
CCDB · ipcn-api-dl — Montmollin, B. d. 1982. 2317. Bull. Soc. Neuchateloise Sci. Nat. 105: 65–77.
CCDB · ipcn-api-dl — Franzen, R. & L. A. Gustavsson. 1983. Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101–106.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Gukasian, A. G. & A. B. Safarian. 1990. Chromosome numbers of some representatives of Armenian flora. Biol. Zurn. Armen. 43: 259–260.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Goukasian, A. G. & A. A. Nersesian. 1992. Karyological study of species of Silene L. (Caryophyllaceae) from southern Transcaucasia. Pp. 18–19 <in> Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · ipcn-api-dl — Baltisberger, M. & E. Baltisberger. 1995. Cytological data of Albanian plants. Candollea 50(2): 457–493.
CCDB · ipcn-api-dl — Nersesian, A. A. & A. G. Goukasian. 1995. On the karyology of the representatives of the genus Silene L. s. l. (Caryophyllaceae) from southern Transcaucasia. Thaiszia 5: 13–19.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
+73 more references
2n 4819×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4
CCDB · iber-fl — The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. Blackburn, K. B. & J. K. Morton.New Phytol.56: 344-351(1957).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).
CCDB · fl-europaea — K. Larsen, ined.
CCDB · ipcn-api-dl — Horovitz, A. & R. Dolberger. 1983. The genetic basis of gender in Silene vulgaris. Heredity 51: 371–376.
CCDB · ipcn-api-dl — DEGRAEVE, N. 1980a. Etude de diverses particularites caryotypiques des genres Silene, Lychnis et Melandrium. Bol. Soc. Brot., sér. 2 2, 53: 595–643.
CCDB · ipcn-api-dl — Baltisberger. 2004. Cytological data of some plant species from Israel. Israel J. Pl. Sci. 52: 171–176.
CCDB · book-ipcn66 — Damboldt & Phitos 1966; Morisset 1966
CCDB · book-ipcn67-71 — DAMBOLDT, J., & D. PHITOS. 1970. In IOPB chromosome number report XXVI. Taxon 19: 264-269.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.T. LEITAO. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal III. Cariophyllaceae. Bol. soc. Brot. 45 (ser. 2): 143-176.
CCDB · book-fedorov — Blackburn, Morton 1957
CCDB · book-fedorov — Larsen 1960b
CCDB · CromoCat 2015 — Horovitz, A. & Dolberger, R (1983). The genetic basis of gender in Silene vulgaris
Silene vulgaris. Heredity 51:371-376
CCDB · CromoCat 2015 — Baltisberger, M. & Baltisberger, E. (1995). Cytological data of Albanian plants. Candollea 50(2): 457-493.
CCDB · CromoCat 2015 — Damboldt, J. & Phitos, D. (1968). Zur Cytotaxonomie einiger Arten der Gattung Silene L. (Caryophyllaceae). Verh. Bot. Vereins Prov. Brandenburg 105: 44-51.
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.
CCDB · CromoCat 2015 — Melzheimer, V. & J. Damboldt. (1973). Zur morphologie und cytologie tetraploider sippen von Silene vulgaris (Caryophyllaceae). Willdenowia 7: 83-100.
CCDB · CromoCat 2015 — Runemark, H. (1996). Mediterranean chromosome number reports-6 Fl. Medit. 6: 223-243.
CCDB · CromoCat 2015 — Damboldt, J. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVI]. Taxon 19(2): 265.
2n 122×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 11
CCDB · CromoCat 2015 — Miège, J. & W. Greuter. (1973). Nombres chromosomiques de quelques plantes récoltées en Crète. Ann. Mus. Goulandris 1: 105-111.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
n 127×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Notas sobre el gnero Silene L. en Espaa. II. Talavera, S. & G. Bocquet.Lagascalia6(1): 101-116(1976).
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · book-ipcn67-71 — HAMET-AHTI L. & v. VIRRANKOSKI. 1970. Chromosome numbers of some vascular plants of north Finland. Ann. Bot. Fenn. 7: 177.
CCDB · CromoCat 2015 — Cauderon, Y. (1958). Étude cytogénétique des Agropyrum français et de leurs hybrides avec les blés. Ann. Inst. Natl. Rech. Agron., Ser. B. 8: 389-543.
CCDB · CromoCat 2015 — Melzheimer, V. & J. Damboldt. (1973). Zur morphologie und cytologie tetraploider sippen von Silene vulgaris (Caryophyllaceae). Willdenowia 7: 83-100.
CCDB · CromoCat 2015 — Hämet-Ahti, L. & Virrankoski, V. (1970). Chromosome numbers of some vascular plants of north Finland. Ann. Bot. Fenn. 7: 177-181.
n 245×CCDB · iapt · CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
TreeOfSex · plant — Goldblatt1979 ↗
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Horovitz, A. & Dolberger, R (1983). The genetic basis of gender in Silene vulgaris
Silene vulgaris. Heredity 51:371-376
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelContig
07Deep time~0.97 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.97 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type372 138 records
Wild obs. + sensor360 015
Museum / vouchered10 622
Cultivated / captive72
Other1 429
Origin
Native8 882
Introduced158
Range
Area of Occupancy AOO502 864 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 107 559≤1 km 33 862≤10 km 136 473>10 km 2 581
280 475 georeferenced · 79 540 without coordinates
Open the mapobservation + sensor360 015
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 607≤1 km 1 886≤10 km 3 138>10 km 963
6 594 georeferenced · 4 028 without coordinates
Open the institutions mapphysical evidence10 622
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 32>10 km 20
52 georeferenced · 20 without coordinates
Open the mapnot free-living72
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions170 of 303 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 926 |
| Helsinki, FI | 713 |
| Moscow State Universitylocation not on record | 504 |
| LDlocation not on record | 445 |
| BFLlocation not on record | 357 |
| Oulu, FI | 225 |
| MeiseBGlocation not on record | 225 |
| Berlin, DE | 176 |
| Montréal, CA | 173 |
| South Kensington, GB | 173 |
| Salzburg, AT | 167 |
| Chongqing Museumlocation not on record | 165 |
| Zürich, CH | 159 |
| Paris, FR | 142 |
| Olocation not on record | 141 |
| GMBAlocation not on record | 133 |
| Oskarshamn, SE | 117 |
| College of the Atlantic, Museumlocation not on record | 114 |
| Uniwersytet Warszawskilocation not on record | 106 |
| Turku, FI | 105 |
| Tartu, EE | 102 |
| SLU Artdatabankenlocation not on record | 93 |
| Jyväskylä, FI | 92 |
| Madison, US | 89 |
| València, ES | 84 |
| MAlocation not on record | 78 |
| CICYTEXlocation not on record | 76 |
| Museo Entomologico de Leonlocation not on record | 72 |
| Adelaide, AU | 72 |
| Wlocation not on record | 67 |
| Trondheim, NO | 65 |
| Uniwersytet Śląski w Katowicachlocation not on record | 65 |
| TROMlocation not on record | 62 |
| Toronto, CA | 62 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 60 |
| BRNUlocation not on record | 60 |
| Görlitz, DE | 51 |
| Saint John, CA | 50 |
| Victoria, CA | 48 |
| Bronx, US | 48 |
| Córdoba, ES | 48 |
| Kew, GB | 47 |
| Acadia Universitylocation not on record | 47 |
| Ann Arbor, US | 47 |
| TUR-Alocation not on record | 45 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 43 |
| Allentown, US | 42 |
| Durham, US | 42 |
| Yangling, CN | 40 |
| KMNlocation not on record | 38 |
| BClocation not on record | 37 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 36 |
| Green Bay, US | 36 |
| Corvallis, US | 34 |
| BDBClocation not on record | 32 |
| Zürich, CH | 32 |
| WTUlocation not on record | 31 |
| Kuopio, FI | 30 |
| Tallinn, EE | 29 |
| Wuzhou, CN | 29 |
| Burlington, US | 28 |
| Pullman, US | 28 |
| Barcelona, ES | 27 |
| Karlsruhe, DE | 27 |
| UIBlocation not on record | 27 |
| Entomological Society of Latvialocation not on record | 26 |
| Podgorica, ME | 25 |
| KIRMlocation not on record | 25 |
| Université Lavallocation not on record | 24 |
| Bloomington, US | 23 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 23 |
| Hobart, AU | 22 |
| Provincia di Livornolocation not on record | 22 |
| Adam Mickiewicz University in Poznańlocation not on record | 21 |
| Bergen, NO | 19 |
| Moscow, US | 18 |
| Vancouver, CA | 18 |
| Salamanca, ES | 16 |
| GZUlocation not on record | 16 |
| PRClocation not on record | 16 |
| Frankfurt am Main | 16 |
| Beijing, CN | 16 |
| WINlocation not on record | 15 |
| Williamsburg, US | 15 |
| Tilburg, NL | 15 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 14 |
| Pamplona, ES | 14 |
| Rovaniemi, FI | 13 |
| Canberra, AU | 13 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 13 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 12 |
| Bozeman, US | 12 |
| GJOlocation not on record | 12 |
| Flagstaff, US | 12 |
| Spearfish, US | 12 |
| Millersville, US | 12 |
| Porrentruy, CH | 12 |
| Missoula, US | 11 |
| Tampa, US | 11 |
| Christchurch, NZ | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| Denver, US | 10 |
| Fulda, DE | 10 |
| BIO-UNIPIlocation not on record | 10 |
| Uppsala, SE | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Alicante, ES | 10 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 10 |
| Glarus, CH | 10 |
| Longwood Universitylocation not on record | 9 |
| Mlocation not on record | 9 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 9 |
| Harrisonburg, US | 8 |
| Tula State Universitylocation not on record | 8 |
| Chadron, US | 8 |
| Claremont, US | 8 |
| Whitehorse, CA | 7 |
| H-Schuhwlocation not on record | 7 |
| Kensington, AU | 7 |
| Granada, ES | 7 |
| Hudson, US | 7 |
| BSBIlocation not on record | 7 |
| DBF-NHMDlocation not on record | 7 |
| University of Stellenboschlocation not on record | 7 |
| Frauenfeld, CH | 7 |
| Philadelphia, US | 7 |
| Saint Louis, US | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Arcata, US | 7 |
| New Brunswick, US | 7 |
| Madrid, ES | 7 |
| Davis, US | 6 |
| Northeastern Forestry Universitylocation not on record | 6 |
| Yukon Universitylocation not on record | 6 |
| Odawara, JP | 6 |
| Nagano City, JP | 6 |
| Stockholm, SE | 6 |
| CASlocation not on record | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| nbflocation not on record | 5 |
| Vitoria, ES | 5 |
| Dekalb, US | 5 |
| Porvoo, FI | 5 |
| Mount Annan, AU | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Dresden, DE | 5 |
| Columbia, US | 5 |
| OLAlocation not on record | 5 |
| Forssa, FI | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Portland, US | 5 |
| Winterthur, CH | 5 |
| CZE096location not on record | 4 |
| Dover, US | 4 |
| EL PASO, US | 4 |
| Nanjing, CN | 4 |
| Lincoln, US | 4 |
| Riverside, US | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| Garðabær, IS | 4 |
| San Isidro, AR | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Badajoz, ES | 4 |
| Tsukuba, JP | 4 |
| Tomioka, JP | 4 |
| Norfolk, US | 4 |
| Bern, CH | 4 |
| Philadelphia, US | 4 |
| JBSlocation not on record | 4 |
| Oswego, US | 3 |
| College Park, US | 3 |
| nlocation not on record | 3 |
| Bourges, FR | 3 |
| Sevilla, ES | 3 |
| Fairfax, US | 3 |
| CJBGlocation not on record | 3 |
| SZUlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Clemson, US | 3 |
| Nijmegen, NL | 3 |
| Ivano-Frankove, UA | 3 |
| Brookings, US | 3 |
| 3 | |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Anchorage, US | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Palmerston North, NZ | 3 |
| Provo, US | 3 |
| Philadelphia, US | 3 |
| Brisbane, AU | 3 |
| Québec, CA | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Guangzhou, CN | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| University of New Hampshirelocation not on record | 3 |
| Monastir, TN | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| USFS/BHSClocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Otaru, JP | 2 |
| Bangkok, TH | 2 |
| QVMAGlocation not on record | 2 |
| Phoenix, US | 2 |
| Bando, JP | 2 |
| Namur, BE | 2 |
| UoB-IBlocation not on record | 2 |
| Whitewater, US | 2 |
| ASUlocation not on record | 2 |
| Tacoma, US | 2 |
| Taipei, TW | 2 |
| National Museum Waleslocation not on record | 2 |
| Chiba, JP | 2 |
| Boise, US | 2 |
| Little Rock, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Ypsilanti, US | 2 |
| NMBU:MINAlocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| B.A. Bennett Herbariumlocation not on record | 2 |
| Logan, US | 2 |
| Auckland, NZ | 2 |
| San Diego, US | 2 |
| Kunming, CN | 1 |
| Santa Barbara, US | 1 |
| Parkville, AU | 1 |
| Lausanne, CH | 1 |
| KNFYlocation not on record | 1 |
| Emporia, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Chapel Hill, US | 1 |
| FLADlocation not on record | 1 |
| Xiamen, CN | 1 |
| Universität Ulmlocation not on record | 1 |
| BMlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Miami, US | 1 |
| Bothell, US | 1 |
| York University, Packer Collectionlocation not on record | 1 |
| Toyama, JP | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| JP | 1 |
| ROM007location not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| University of Genevalocation not on record | 1 |
| Albuquerque, US | 1 |
| Trois-Rivières, CA | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Johnson City, US | 1 |
| Corrientes, AR | 1 |
| Durango, US | 1 |
| Santa Cruz, US | 1 |
| München, DE | 1 |
| Cape Town, ZA | 1 |
| WAGlocation not on record | 1 |
| Beijing, CN | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Dhaka, BD | 1 |
| Russellville, US | 1 |
| San Sebastián, ES | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Banyoles, ES | 1 |
| BGBMlocation not on record | 1 |
| Cambridge, US | 1 |
| KNFHClocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| SWlocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Morgantown, US | 1 |
| AUT001location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Kushiro City Museumlocation not on record | 1 |
| ESP109location not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| ESP004location not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| INTAlocation not on record | 1 |
| Knoxville, US | 1 |
| St. Paul, US | 1 |
| Herb. BBGlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Fayetteville, US | 1 |
| ESP003location not on record | 1 |
| Göteborg, SE | 1 |
| Edinburgh, GB | 1 |
303 institutions · 9 819 of 10 622 vouchered records shown · 617 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA324 detections
Where the DNA of Silene vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found324
Studies independent surveys2
Countries14
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 324 detections have coordinates
Open the map14 countries0
Grassland hillsideat edge of cliffRich riparian soil with a mixture of deciduo…Rocky on slope with Lupine, Geum, Eriogonum,…Disturbed gravelly area. Site of old buildin…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median5.80 °C 5.60–16.5
Seasonal swing summer↔winter23.9 °C
Max temp (day)9.60 °C 9.50–19.8
Min temp (night)-0.1 °C -0.2–10.4
Precipitation218 mm/mo 89.0–218
Air humidity63.3 % 56.4–63.3
Moisture balance104 mm/mo -4.70–104
Vapour deficit340 Pa 337–820
Wind speed2.90 m/s 1.40–3.20
Cloud cover30.7 % 30.4–41.3
CHELSA 1981–2010, ~9 km grid, at location & month of 291 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.