Pilosocereus pachycladus

F.Ritter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records902

Data sources9

Biological traits24

DNA specimens6

eDNA detections0

Sources9 archives

Databases and archives Pilosocereus pachycladus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility902 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF902 records

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

miniatur|Pilosocereus pachycladus Bahia 2018 Pilosocereus pachycladus ist eine Pflanzenart in der Gattung Pilosocereus aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton pachycladus bedeutet ‚mit dicken Zweigen‘. Trivialnamen sind „Facheiro“, „Facheiro Azul“ und „Mandacarú de Facho“.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length45 mm

Fruit length max45 mm

Fruit length min45 mm

Plant height3.1 m

Plant height max10 m

Life cycle & reproduction5

Deciduousnessstem succulent

Dehiscenceindehiscent

Dispersal typeanimal

Life formsucculent shrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyte detailedterrestrial

Fruit typeberry

Growth formshrub

Habitat GIFTCaatinga (stricto sensu), Campo Rupestre, Carrasco, Floresta Estacional Decidual, Vegetação Sobre Afloramentos Rochosos

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry3

Leaf n17.93 mg/g

Photosynthetic pathwayCAM

Wood density530 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus pachycladus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

The DNA barcodea real sequence read deposited for this species

ITSOP188771.1 ↗472 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Pilosocereus pachycladus isolate S40A1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lennoa madreporoidessame order3.0%Ipomoea batatassame order4.2%Panax quinquefoliussame order4.5%Jasminum sambacsame order4.5%Cucumis sativussame order5.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL1★ITS4

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pilosocereus pachycladus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–442n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · iapt

CCDB · iapt

2n 442×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 18

CCDB · iapt — IAPT/IOPB Chromosome Data 30

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type902 records

Wild obs. + sensor731

Museum / vouchered170

Other1

Origin

Native82

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 33≤1 km 11≤10 km 4>10 km 5

53 georeferenced · 678 without coordinates

Open the mapobservation + sensor731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 170 records without

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidade Federal do Vale do São Franciscolocation not on record	39
Departamento de Sistematica e Ecologialocation not on record	19
Laboratorio de Ictiologialocation not on record	13
Kew, GB	13
UFBAlocation not on record	11
USP-IBlocation not on record	8
Cruz das Almas, BR	8
Universidade Federal do Rio Grande do Nortelocation not on record	8
UFSCarlocation not on record	7
Salvador, BR	6
UFRPElocation not on record	6
UnBlocation not on record	4
JBRJlocation not on record	4
UFPElocation not on record	3
Ilhéus, BR	3
Universidade Federal de Sergipe (UFS)location not on record	3
Feira de Santana, BR	3
Universidade Federale do Rio Grande do Sullocation not on record	3
UFPRlocation not on record	2
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	2
CPATSAlocation not on record	1
Teresina, BR	1
HACAMlocation not on record	1
Tampa, US	1
UNIVASFlocation not on record	1

25 institutions · 170 of 170 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)