Semioscopis inornata

Walsingham, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Semioscopis

At a glance

Occurrence records802

Data sources7

Biological traits0

DNA specimens100

eDNA detections100

Sources7 archives

Databases and archives Semioscopis inornata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility802 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics100 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF802 records

Environmental DNA1 datasets · 2 countries100 detections

DNA & barcodingBOLD100 specimens

01Narrative

Semioscopis inornata, the dull flatbody moth, is a species of moth of the family Depressariidae. It was described by Walsingham in 1882. It is found throughout Canada and northern United States. The length of the forewings is 10.5–15 mm. The forewings are bluish-gray. Adults are on wing from early April to the end of May in one generation per year. The larvae feed on Populus tremuloides, Populus grandidentata, Populus balsamifera and Salix species. They roll the leaves of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding100 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semioscopis inornata has left across the world's sequence archives.

At a glance

DNA specimens100

BINs2

Marker genes1

eDNA detections100

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

44Cmostly conserved

202Amostly conserved

628Gmostly conserved

TACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTCGGACTATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes11

BINs2

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semioscopis strigulanasame genus3.2%Semioscopis mcdunnoughisame genus5.0%Semioscopis avellanellasame genus5.3%Semioscopis megamicrellasame genus5.5%Semioscopis steinkellnerianasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type802 records

Wild obs. + sensor401

Museum / vouchered401

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 274≤1 km 33≤10 km 11>10 km 20

338 georeferenced · 63 without coordinates

Open the mapobservation + sensor401

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 4≤1 km 98≤10 km 49>10 km 17

168 georeferenced · 233 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	94
University of Alberta Museums (UAM)location not on record	80
University of Guelph, Centre for Biodiversity Genomicslocation not on record	49
New Haven, US	38
Cambridge, US	16
UNHClocation not on record	10
Washington, US	8
Edmonton, CA	8
St. Paul, US	7
Centre for Biodiversity Genomicslocation not on record	3
Royal Saskatchewan Museumlocation not on record	2
SOVTlocation not on record	2
Mississippi State, US	1
San Francisco, US	1
Cornell University Insect Collectionlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

16 institutions · 321 of 401 vouchered records shown · 80 without an institution code

09Environmental DNA100 detections

Where the DNA of Semioscopis inornata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.80 °C 5.10–12.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)12.2 °C 9.80–18.6

Min temp (night)1.80 °C 0.7–7.90

Precipitation75.0 mm/mo 67.0–98.2

Air humidity54.8 % 54.7–57.6

Moisture balance-11.0 mm/mo -35.6–26.3

Vapour deficit448 Pa 372–667

Wind speed4.00 m/s 2.70–4.00

Cloud cover47.9 % 43.4–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 99 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)