Semicassis labiata

(Perry, 1811) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Cassidae/Semicassis

At a glance

Occurrence records1 161

Data sources8

Biological traits4

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Semicassis labiata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility904 records↗

OBISOcean Biodiversity Information System257 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 161 records

DNA & barcodingBOLD4 specimens

01Narrative

Semicassis labiata (formerly also known as Phalium labiatum) is a species of large predatory sea snail, a marine gastropod mollusc. This species is in the subfamily Cassinae, the "helmet shells" and "bonnet shells", which feed on sea urchins.Gofas, S. (2012). Semicassis labiata (Perry, 1811). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=533621 on 2012-07-15

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max84 m

Depth min25 m

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semicassis labiata has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 5 variable positions, in barcode order

79Gmostly conserved

217Amostly conserved

406Tmostly conserved

578Cmostly conserved

580Gmostly conserved

TACTCTATATATTTTATTTGGTATGTGATCAGGACTGGTAGGAACAGCTTTAAGTTTATTAATTCGAGCAGAATTAGGGCAACCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phalium flammiferumsame family10.1%Semicassis bisulcatasame genus10.9%Phalium glaucumsame family11.4%Casmaria ponderosasame family12.0%Tutufa bufosame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 161 records

Wild obs. + sensor490

Museum / vouchered670

Other1

Range

Area of Occupancy AOO1 720 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 42.5 m · max 113 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 360≤1 km 47≤10 km 17>10 km 6

430 georeferenced · 60 without coordinates

Open the mapobservation + sensor490

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 13≤1 km 249≤10 km 146>10 km 47

455 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence670

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	129
Wellington, NZ	75
Auckland, NZ	59
Philadelphia, US	25
Museum and Art Gallery of the Northern Territorylocation not on record	22
Museums Victorialocation not on record	22
Cambridge, US	21
Natick, US	15
Tasmanian Museum & Art Gallerylocation not on record	11
Denver, US	10
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	8
Chongqing Museumlocation not on record	7
Santa Barbara Museum of Natural Historylocation not on record	4
QVMAGlocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
Brussels, BE	3
RBINS-Scientific Heritagelocation not on record	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
PUC-RSlocation not on record	2
Washington, US	2
Paleontological Research Institutionlocation not on record	1
Los Angeles, US	1

24 institutions · 434 of 670 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Semicassis labiata

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type1 161 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Record type1 161 records