Schizocosa mccooki

(Montgomery, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Schizocosa

At a glance

Occurrence records2 640

Data sources9

Biological traits8

DNA specimens272

eDNA detections270

Sources9 archives

Databases and archives Schizocosa mccooki's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 640 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI270 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics272 specimens↗

World Spider Trait DBMasaryk University8 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF2 640 records

Environmental DNA1 datasets · 2 countries270 detections

DNA & barcodingBOLD272 specimens

01Narrative

Schizocosa mccooki is a species of wolf spider in the family Lycosidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCraig et al. 2020Dondale & Redner 1990Greenstone & Bennett 1980

Morphometry4

Body length♀16.15·♂12.3 mm

Body mass0.512 mm

Cephalothorax length♀5.99·♂5.35 mm

Cephalothorax width♀4.46·♂4.06 mm

Physiology1

Resting metabolic rate0.001 mm

Biomechanics3

Silk strain0.24 mm

Silk strength555 mm

Silk toughness60 mm

05DNA & barcoding272 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schizocosa mccooki has left across the world's sequence archives.

At a glance

DNA specimens272

BINs1

Marker genes1

eDNA detections270

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus269 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

25Gvariable

37Amostly conserved

121Amostly conserved

211Amostly conserved

301Gmostly conserved

361Gmostly conserved

364Cmostly conserved

367Amostly conserved

412Gmostly conserved

469Amostly conserved

475Amostly conserved

496Gmostly conserved

628Amostly conserved

TTTATATTTAATATTTGGTGTTTGGTCAGCAATATTAGGGACTGCTATAAGTGTGTTAATTCGGATGGAATTAGGAAATTCTGGAAGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 49 variants.

Diversity (π)0.97%

Haplotypes49

BIN1

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schizocosa maximasame genus4.7%Schizocosa retrorsasame genus5.7%Schizocosa avidasame genus6.0%Schizocosa crassipalpatasame genus6.1%Schizocosa bilineatasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 640 records

Wild obs. + sensor1 158

Museum / vouchered1 482

Origin

Native7

Range

Area of Occupancy AOO4 940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 653≤1 km 123≤10 km 57>10 km 94

927 georeferenced · 231 without coordinates

Open the mapobservation + sensor1 158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 513≤1 km 32≤10 km 31>10 km 5

581 georeferenced · 901 without coordinates

Open the institutions mapphysical evidence1 482

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	755
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	475
Vancouver, CA	63
Albuquerque, US	36
Royal Saskatchewan Museumlocation not on record	27
Chicago, US	25
Awka, NG	21
San Diego, US	19
Los Angeles, US	7
Edmonton, CA	6
US	6
Mexico City, MX	6
US	5
Cambridge, US	5
Ohio State University Acarology Laboratorylocation not on record	5
La Paz, MX	5
Royal British Columbia Museumlocation not on record	2
Buenos Aires, AR	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
San Francisco, US	2
Champaign, US	1
Biodiversity Institute of Ontariolocation not on record	1
Lubbock, US	1

23 institutions · 1 477 of 1 482 vouchered records shown · 5 without an institution code

09Environmental DNA270 detections

Where the DNA of Schizocosa mccooki was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found270

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 270 detections have coordinates

Open the map2 countries0

Grasslandunder rock1. Forest & Woodland | 1.4. Temperate Forest4. Grassland | 4.4. Grassland - Temperate4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 13.2–21.2

Seasonal swing summer↔winter25.1 °C

Max temp (day)25.7 °C 20.2–28.8

Min temp (night)10.0 °C 5.90–13.2

Precipitation39.3 mm/mo 23.3–78.3

Air humidity49.1 % 45.0–53.2

Moisture balance-122 mm/mo -155–-56.0

Vapour deficit1,161 Pa 747–1,295

Wind speed2.30 m/s 2.20–2.90

Cloud cover29.9 % 29.5–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 268 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Schizocosa mccooki

At a glance

Sources9 archives

Morphometry4

Physiology1

Biomechanics3

At a glance

Record type2 640 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 640 records