Schizocosa avida

(Walckenaer, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Schizocosa

At a glance

Occurrence records1 452

Data sources8

Biological traits4

DNA specimens35

eDNA detections34

Sources8 archives

Databases and archives Schizocosa avida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 452 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

World Spider Trait DBMasaryk University4 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF1 452 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD35 specimens

01Narrative

Schizocosa avida is a species of wolf spider in the family Lycosidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990Pekár et al. 2012a

Morphometry3

Body length♀10.65·♂8.05 mm

Cephalothorax length♀5.31·♂4.62 mm

Cephalothorax width♀3.94·♂3.57 mm

Predation1

Prey diversity7.14 mm

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schizocosa avida has left across the world's sequence archives.

At a glance

DNA specimens35

BINs5

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

1Avariable

7Gmostly conserved

13Amostly conserved

40Amostly conserved

61Avariable

100Gmostly conserved

112Amostly conserved

124Gmostly conserved

148Amostly conserved

160Amostly conserved

163Gmostly conserved

190Gmostly conserved

208Avariable

211Gvariable

214Amostly conserved

229Amostly conserved

262Amostly conserved

280Amostly conserved

289Amostly conserved

304Amostly conserved

319Gvariable

328Amostly conserved

370Avariable

415Gmostly conserved

430Amostly conserved

442Tmostly conserved

451Gmostly conserved

469Gmostly conserved

475Amostly conserved

487Gvariable

499Gmostly conserved

511Amostly conserved

514Amostly conserved

532Amostly conserved

541Amostly conserved

577Avariable

580Amostly conserved

583Gmostly conserved

592Amostly conserved

616Cvariable

631Gmostly conserved

AACTTTGTATTTAATATTTGGTGTTTGGTCAGCAATATTAGGGACTGCTATAAGTGTATTAATTCGAATAGAATTAGGTAATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes16

BINs5

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schizocosa maximasame genus5.4%Schizocosa saltatrixsame genus5.5%Schizocosa bilineatasame genus5.8%Schizocosa mccookisame genus6.0%Schizocosa retrorsasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 452 records

Wild obs. + sensor1 131

Museum / vouchered315

Other6

Range

Area of Occupancy AOO3 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 703≤1 km 107≤10 km 36>10 km 140

986 georeferenced · 145 without coordinates

Open the mapobservation + sensor1 131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 41≤1 km 17≤10 km 105>10 km 17

180 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	97
Denver, US	73
Chicago, US	31
Cambridge, US	31
Ohio State University Acarology Laboratorylocation not on record	31
Sam Noble Oklahoma Museum of Natural Historylocation not on record	26
Mexico City, MX	5
Chicago, US	4
Cincinnati, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Biodiversity Institute of Ontariolocation not on record	2

11 institutions · 307 of 315 vouchered records shown · 8 without an institution code

09Environmental DNA34 detections

Where the DNA of Schizocosa avida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

Wetlandunder rockGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 12.5–25.7

Seasonal swing summer↔winter24.0 °C

Max temp (day)26.2 °C 17.9–30.4

Min temp (night)16.6 °C 7.70–22.0

Precipitation100 mm/mo 78.9–130

Air humidity58.0 % 55.1–59.8

Moisture balance-37.7 mm/mo -73.2–-14.2

Vapour deficit1,022 Pa 634–1,387

Wind speed3.60 m/s 2.70–4.70

Cloud cover39.5 % 32.4–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Schizocosa avida

At a glance

Sources8 archives

Morphometry3

Predation1

At a glance

Record type1 452 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 452 records