Schistura multifasciata — The Life Data

Animalia/Chordata/Cypriniformes/Nemacheilidae/Schistura

At a glance

Occurrence records2

Data sources7

Biological traits5

DNA specimens12

eDNA detections0

Sources7 archives

Databases and archives Schistura multifasciata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF2 records

DNA & barcodingBOLD12 specimens

01Narrative

Schistura multifasciata is a species of ray-finned fish, a stone loach in the genus Schistura. It is found in the eastern Himalayas, from the Teesta River, through the base of the Nepal Himalaya, as far as the Ghaghara and Sharda River drainages, where it lives on the gravel bottoms of fast flowing hill streams.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length9.8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schistura multifasciata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P476 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

36Gmostly conserved

ATAATCTTCTTTATAGTAATGCCCATCCTCATTGGGGGATTCGGAAACTGACTTGTACCCCTAATAATTGGGGCCCCCGACATGGCATTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schistura sijuensissame genus9.5%Schistura mahnertisame genus9.9%Schistura rupeculasame genus10.9%Schistura vinciguerraesame genus10.9%Schistura pridiisame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	2

1 institutions · 2 of 2 vouchered records shown