Schistura mahnerti

Kottelat, 1990 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Nemacheilidae/Schistura

At a glance

Occurrence records81

Data sources8

Biological traits4

DNA specimens10

eDNA detections0

Sources8 archives

Databases and archives Schistura mahnerti's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF81 records

DNA & barcodingBOLD10 specimens

01Narrative

Schistura mahnerti is a species of tropical freshwater fish of the stone loach family Nemacheilidae. It inhabits fast-flowing streams of Thailand and Myanmar (Burma). S. mahnerti is one of the more recent species to be introduced to the aquarium trade. Other common names for this fish include the Burmese-border sand loach and red-tail sand loach. It is sometimes mislabeled in pet stores as a zebra loach or Burmese Border loach, which are both members of the genus Botia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.4 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schistura mahnerti has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P682 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

20Tvariable

229Cmostly conserved

286Tvariable

328Cmostly conserved

385Gmostly conserved

487Tmostly conserved

490Cvariable

AGACATTGGCACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGTACCGCTCTTAGCCTTCTAATTCGAGCTGAACTAAGCCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes3

BIN1

Most divergent pair0.73%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schistura rupeculasame genus5.3%Schistura beavanisame genus7.0%Schistura sijuensissame genus7.0%Pteronemacheilus lucidorsumsame family7.2%Schistura paucireticulatasame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type81 records

Museum / vouchered81

Range

Area of Occupancy AOO204 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 81 records without

Open the institutions mapphysical evidence81

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	72
Stockholm, SE	1

2 institutions · 73 of 81 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)