Rhyparochromus vulgaris

(Schilling, 1829) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Rhyparochromus

At a glance

Occurrence records39 935

Data sources7

Biological traits0

DNA specimens35

eDNA detections59

Sources7 archives

Databases and archives Rhyparochromus vulgaris's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 935 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF39 935 records

Environmental DNA3 datasets · 11 countries59 detections

DNA & barcodingBOLD35 specimens

01Narrative

Rhyparochromus vulgaris is a species of dirt-colored seed bug in the family Rhyparochromidae. It is found in Africa, Europe and Northern Asia (excluding China), North America, and Southern Asia. This bug was first recorded in North America in 2001. Rhyparochromus vulgaris is sometimes considered a member of the genus Raglius, Raglius vulgaris.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhyparochromus vulgaris has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections59

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

58Gmostly conserved

90Tmostly conserved

172Cmostly conserved

200Amostly conserved

202Cmostly conserved

217Cmostly conserved

259Cmostly conserved

283Cmostly conserved

307Amostly conserved

343Tmostly conserved

346Tmostly conserved

490Tmostly conserved

499Cmostly conserved

553Tmostly conserved

631Gmostly conserved

643Cmostly conserved

646Cmostly conserved

GACATTATATTTCATTTTTGGTATATGATCTGGAATAGTGGGATCATCATTAAGATGGATCATTCGAATTGAGCTGGGACAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs2

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhyparochromus pinisame genus11.1%Sphragisticus nebulosussame family12.0%Rhyparochromus phoeniceussame genus12.6%Lamprodema maurasame family12.8%Megalonotus chiragrasame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type39 935 records

Wild obs. + sensor39 851

Museum / vouchered64

Cultivated / captive3

Other17

Range

Area of Occupancy AOO47 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 10 967≤1 km 2 838≤10 km 18 043>10 km 648

32 496 georeferenced · 7 355 without coordinates

Open the mapobservation + sensor39 851

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 8≤1 km 12≤10 km 4

24 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence64

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	4
Provincia di Livornolocation not on record	3
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
South Kensington, GB	3
SLU Artdatabankenlocation not on record	1

6 institutions · 25 of 64 vouchered records shown · 39 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA59 detections

Where the DNA of Rhyparochromus vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys3

Countries11

Verifiable raw sequence linked25

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map11 countries0

RipisylvesPinedes laricio1.1. Boreal Forest|1. Forest & Woodland4. Native Grassland | 4.4. Temperate GrasslandUrban1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 10.1–18.2

Seasonal swing summer↔winter19.1 °C

Max temp (day)17.7 °C 13.6–22.6

Min temp (night)10.2 °C 6.50–14.2

Precipitation65.9 mm/mo 50.7–102

Air humidity61.1 % 56.3–62.8

Moisture balance-22.1 mm/mo -47.8–40.5

Vapour deficit596 Pa 494–885

Wind speed3.70 m/s 2.10–4.40

Cloud cover44.6 % 33.1–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhyparochromus vulgaris

At a glance

Sources7 archives

At a glance

Record type39 935 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions1 of 6 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type39 935 records