Sphragisticus nebulosus

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Sphragisticus

At a glance

Occurrence records2 685

Data sources8

Biological traits0

DNA specimens67

eDNA detections114

Sources8 archives

Databases and archives Sphragisticus nebulosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 685 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI114 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 685 records

Environmental DNA6 datasets · 10 countries114 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Sphragisticus nebulosus is a species of dirt-colored seed bug in the family Rhyparochromidae, found in North America, Europe, and Asia. Sphragisticus nebulosus, Germany

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphragisticus nebulosus has left across the world's sequence archives.

At a glance

DNA specimens67

BINs3

Marker genes1

eDNA detections114

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

28Amostly conserved

43Amostly conserved

106Tmostly conserved

181Amostly conserved

200Gmostly conserved

235Cmostly conserved

263Tmostly conserved

265Amostly conserved

343Tmostly conserved

386Cmostly conserved

391Cmostly conserved

415Amostly conserved

439Cmostly conserved

445Cmostly conserved

470Cmostly conserved

475Tmostly conserved

487Tmostly conserved

490Gmostly conserved

533Cmostly conserved

595Tmostly conserved

610Cmostly conserved

628Gmostly conserved

AACATTATACTTCATTTTTGGTATATGATCTGGAATAATAGGATCTTCATTAAGATGAATTATTCGAATTGAATTAGGACAACCAGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes8

BINs3

Most divergent pair4.3%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xanthochilus saturniussame family10.8%Lamprodema maurasame family11.2%Xanthochilus quadratussame family11.6%Megalonotus chiragrasame family11.7%Neoneides muticussame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Sphragisticus nebulosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 685 records

Wild obs. + sensor2 250

Museum / vouchered402

Other33

Range

Area of Occupancy AOO5 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 632≤1 km 288≤10 km 1 006>10 km 54

1 980 georeferenced · 270 without coordinates

Open the mapobservation + sensor2 250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 81≤1 km 33≤10 km 66

180 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence402

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	102
NHMOlocation not on record	60
College Station, US	32
SLU Artdatabankenlocation not on record	25
Champaign, US	19
Albuquerque, US	19
ZSMlocation not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	7
ZMAAlocation not on record	6
Tartu, EE	5
Bonn, DE	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Edmonton, CA	4
Philadelphia, US	3
Universidad Católica de Manizaleslocation not on record	2
NTNU-VMlocation not on record	2
neflocation not on record	2
Jyväskylä, FI	2
UO-CeStuBiolocation not on record	1
Lubbock, US	1
Awka, NG	1
Cambridge, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
Mexico City, MX	1
US	1
Forssa, FI	1

27 institutions · 323 of 402 vouchered records shown · 79 without an institution code

09Environmental DNA114 detections

Where the DNA of Sphragisticus nebulosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found114

Studies independent surveys6

Countries10

Verifiable raw sequence linked48

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 114 detections have coordinates

Open the map10 countries0

4. Native Grassland | 4.4. Temperate Grassland1.1. Boreal Forest|1. Forest & Woodland1. Forest & Woodlandfarm1. Forest & Woodland|1.1. Boreal ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 10.0–19.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.6 °C 14.9–26.2

Min temp (night)12.2 °C 3.70–14.1

Precipitation73.8 mm/mo 37.0–84.1

Air humidity60.0 % 51.3–62.1

Moisture balance-35.7 mm/mo -99.2–-12.9

Vapour deficit741 Pa 479–1,085

Wind speed3.50 m/s 2.50–4.00

Cloud cover45.6 % 33.0–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphragisticus nebulosus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 685 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 685 records