Raphiptera argillaceellus

Packard, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Raphiptera

At a glance

Occurrence records712

Data sources7

Biological traits0

DNA specimens42

eDNA detections45

Sources7 archives

Databases and archives Raphiptera argillaceellus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF712 records

Environmental DNA1 datasets · 3 countries45 detections

DNA & barcodingBOLD42 specimens

01Narrative

Raphiptera is a genus of moths of the family Crambidae. It contains only one species, Raphiptera argillaceellus, the diminutive grass-veneer, which is found in eastern North America, where it has been recorded from Labrador, Ontario, Wisconsin, Connecticut, New York, Quebec, Alberta and Michigan. The range extends to Florida and Texas in the south-eastmothphotographersgroup and Costa Rica in Central America.BOLD Systems The habitat consists of bogs. The wingspan is 10–15 mm. The forewings are mouse grey with a silvery white median stripe and a white chevron and a triangular patch at the wing tip. The hindwings are light grey. Adults are on wing from June to August.Bug Guide The larvae probably feed on grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Raphiptera argillaceellus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections45

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

58Avariable

112Tvariable

214Avariable

277Tvariable

278Tvariable

295Cvariable

310Amostly conserved

403Gmostly conserved

407Cvariable

460Cmostly conserved

484Avariable

553Tmostly conserved

622Avariable

628Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes11

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Crambus alienellussame family4.7%Crambus pascuellasame family4.9%Crambus ericellasame family5.0%Crambus heringiellussame family5.0%Crambus youngellussame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type712 records

Wild obs. + sensor596

Museum / vouchered116

Range

Area of Occupancy AOO1 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 295≤1 km 89≤10 km 10>10 km 45

439 georeferenced · 157 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 25≤10 km 41

66 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	39
East Lansing, US	27
New Haven, US	13
CUlocation not on record	12
Philadelphia, US	10
St. Paul, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Cornell University Insect Collectionlocation not on record	2
Cambridge, US	2
SOVTlocation not on record	1

10 institutions · 114 of 116 vouchered records shown · 2 without an institution code

09Environmental DNA45 detections

Where the DNA of Raphiptera argillaceellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map3 countries0

WetlandHammock by canal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 18.4–27.1

Seasonal swing summer↔winter14.3 °C

Max temp (day)31.4 °C 23.1–31.8

Min temp (night)22.2 °C 14.2–23.0

Precipitation182 mm/mo 95.6–233

Air humidity62.6 % 58.4–62.6

Moisture balance29.6 mm/mo -59.1–67.3

Vapour deficit1,263 Pa 890–1,371

Wind speed1.90 m/s 1.90–3.70

Cloud cover34.1 % 32.8–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)