Crambus alienellus

Zincken, 1817 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Crambus

At a glance

Occurrence records283

Data sources5

Biological traits0

DNA specimens67

eDNA detections123

Sources5 archives

Databases and archives Crambus alienellus's data was compiled from.

GBIFGlobal Biodiversity Information Facility283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF283 records

Environmental DNA3 datasets · 6 countries123 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT≈912 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crambus alienellus has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes1

eDNA detections123

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus61 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

23Gvariable

100Avariable

118Tvariable

235Cvariable

238Amostly conserved

247Cvariable

250Cvariable

278Cvariable

287Tvariable

313Tvariable

355Avariable

370Avariable

400Tvariable

403Amostly conserved

412Gvariable

428Cvariable

448Cvariable

460Tvariable

466Avariable

476Avariable

502Avariable

505Tvariable

514Avariable

607Cvariable

AACATTATATTTTATTTTTGGAGTTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes7

BINs2

Most divergent pair3.8%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Crambus daeckellussame genus3.3%Crambus ericellasame genus3.8%Raphiptera argillaceellussame family4.7%Crambus youngellussame genus5.0%Crambus uliginosellussame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Crambus alienellus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈912 038 135 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Crambus alienellus0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99% BUSCO

08Occurrence & distribution

Record type283 records

Wild obs. + sensor169

Museum / vouchered114

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 69≤1 km 31≤10 km 18>10 km 3

121 georeferenced · 48 without coordinates

Open the mapobservation + sensor169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 11≤1 km 18≤10 km 21

50 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	21
DanishLepidopterologicalSocietylocation not on record	13
University of Alberta Museums (UAM)location not on record	12
KWPlocation not on record	8
St. Paul, US	7
Cambridge, US	3
Cornell University Insect Collectionlocation not on record	3
ZSMlocation not on record	2
NMBU:MINAlocation not on record	2
Philadelphia, US	1
Bavarian State Collection of Zoologylocation not on record	1

11 institutions · 73 of 114 vouchered records shown · 41 without an institution code

09Environmental DNA123 detections

Where the DNA of Crambus alienellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys3

Countries6

Verifiable raw sequence linked52

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map6 countries0

WetlandMixed habitatwet bog4. Native Grassland|4.2 Subarctic GrasslandVerger Mixte1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 10.2–16.4

Seasonal swing summer↔winter23.2 °C

Max temp (day)16.7 °C 13.7–19.9

Min temp (night)7.90 °C 6.60–12.4

Precipitation92.1 mm/mo 77.9–149

Air humidity58.8 % 56.1–62.6

Moisture balance-10.1 mm/mo -37.2–45.4

Vapour deficit647 Pa 466–768

Wind speed2.60 m/s 1.80–3.50

Cloud cover45.9 % 37.5–58.4

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)