Pseudopachybrachius basalis

(Dallas, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Pseudopachybrachius

At a glance

Occurrence records922

Data sources7

Biological traits0

DNA specimens26

eDNA detections34

Sources7 archives

Databases and archives Pseudopachybrachius basalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility922 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF922 records

Environmental DNA1 datasets · 3 countries34 detections

DNA & barcodingBOLD26 specimens

01Narrative

Pseudopachybrachius basalis is a species of dirt-colored seed bug in the family Rhyparochromidae. It is found in the Caribbean Sea, Central America, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudopachybrachius basalis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs3

Marker genes1

eDNA detections34

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

4Avariable

19Avariable

43Avariable

70Gmostly conserved

71Tvariable

103Tvariable

139Cvariable

154Cvariable

181Avariable

217Tvariable

232Tvariable

250Avariable

274Cvariable

313Avariable

337Cvariable

340Tmostly conserved

404Cmostly conserved

430Amostly conserved

493Cvariable

530Cvariable

535Avariable

553Tmostly conserved

598Tvariable

TTTATATTTTTTGTTTGGAATATGATCAGGTATAGTAGGATCATCTTTGAGATGAATTATTCGTGTAGAGTTAGGTCAACCAGGAGTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs3

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paromius longulussame family9.6%Pseudopachybrachius guttussame genus9.8%Paromius gracilissame family10.1%Paromius jejunussame family11.2%Pseudopachybrachius vinctussame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type922 records

Wild obs. + sensor665

Museum / vouchered257

Origin

Native2

Range

Area of Occupancy AOO2 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 355≤1 km 99≤10 km 25>10 km 79

558 georeferenced · 107 without coordinates

Open the mapobservation + sensor665

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 18≤10 km 80

100 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	98
College Station, US	59
Durango, MX	41
University of Guelphlocation not on record	30
Mississippi State, US	12
Sam Noble Oklahoma Museum of Natural Historylocation not on record	5
Tapachula, MX	3
Philadelphia, US	2
CUlocation not on record	1
OSUClocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
North Carolina State University Insect Museumlocation not on record	1

12 institutions · 254 of 257 vouchered records shown · 3 without an institution code

09Environmental DNA34 detections

Where the DNA of Pseudopachybrachius basalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 23.4–25.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)29.1 °C 26.9–30.7

Min temp (night)20.5 °C 19.9–22.3

Precipitation48.7 mm/mo 25.8–334

Air humidity63.4 % 60.7–65.9

Moisture balance-117 mm/mo -158–162

Vapour deficit1,059 Pa 961–1,260

Wind speed5.70 m/s 2.70–7.80

Cloud cover16.2 % 13.6–31.1

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)