Pseudopachybrachius vinctus

(Say, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Pseudopachybrachius

At a glance

Occurrence records1 051

Data sources6

Biological traits0

DNA specimens29

eDNA detections24

Sources6 archives

Databases and archives Pseudopachybrachius vinctus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 051 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 051 records

Environmental DNA1 datasets · 5 countries24 detections

DNA & barcodingBOLD29 specimens

01Narrative

Pseudopachybrachius vinctus is a species of dirt-colored seed bug in the family Rhyparochromidae. It is found in the Caribbean, Central America, North America, Oceania, and South America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudopachybrachius vinctus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs4

Marker genes1

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

22Gvariable

43Tmostly conserved

79Cvariable

88Gmostly conserved

115Tvariable

181Avariable

184Avariable

197Tvariable

202Gmostly conserved

206Tmostly conserved

310Avariable

346Cvariable

355Cvariable

364Tvariable

382Amostly conserved

385Tvariable

409Amostly conserved

433Gvariable

469Cvariable

577Gmostly conserved

622Avariable

628Avariable

631Gmostly conserved

634Tvariable

640Cvariable

641Tvariable

643Gvariable

AACTTTATATTTCCTATTTGGGATATGATCAGGAATAATTGGTTCATCTTTAAGATGAATTATTCGTATTGAATTAGGCCAACCAGGGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes4

BINs4

Most divergent pair3.2%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudopachybrachius guttussame genus5.8%Paromius longulussame family9.7%Paromius jejunussame family10.4%Paromius gracilissame family10.4%Eucosmetus incisussame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 051 records

Wild obs. + sensor817

Museum / vouchered234

Range

Area of Occupancy AOO2 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 355≤1 km 109≤10 km 36>10 km 110

610 georeferenced · 207 without coordinates

Open the mapobservation + sensor817

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 3≤1 km 8≤10 km 4

15 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	96
University of Central Floridalocation not on record	48
Durango, MX	36
College Station, US	30
Champaign, US	5
New Haven, US	4
OSUClocation not on record	3
Museo de La Platalocation not on record	3
California Department of Food and Agriculture, California State Collection of Arthropodslocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
CUlocation not on record	1
San Francisco, US	1

12 institutions · 231 of 234 vouchered records shown · 3 without an institution code

09Environmental DNA24 detections

Where the DNA of Pseudopachybrachius vinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland | 1.9. Subtropical/Trop…14. Artificial - Terrestrial|14.5 Urban AreasUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 21.1–25.5

Seasonal swing summer↔winter9.50 °C

Max temp (day)27.0 °C 25.6–30.7

Min temp (night)19.9 °C 17.2–22.1

Precipitation70.0 mm/mo 1.60–502

Air humidity63.0 % 58.2–68.8

Moisture balance-106 mm/mo -148–387

Vapour deficit1,004 Pa 750–1,348

Wind speed2.20 m/s 1.20–3.70

Cloud cover30.0 % 10.9–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pseudopachybrachius vinctus

At a glance

Sources6 archives

At a glance

Record type1 051 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 051 records