Protesilaus telesilaus

(Felder & Felder, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Protesilaus

At a glance

Occurrence records142

Data sources8

Biological traits0

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Protesilaus telesilaus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility142 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF142 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceNCBI≈1.3 Gbp

01Narrative

Protesilaus telesilaus is a species of butterfly of the genus Protesilaus. It is native to the Americas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protesilaus telesilaus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 3 variable positions, in barcode order

409Avariable

601Cmostly conserved

622Gmostly conserved

ATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protesilaus macrosilaussame genus1.8%Protesilaus molopssame genus3.4%Protesilaus protesilaussame genus3.6%Protographium dariensissame family4.4%Protographium dioxippussame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Protesilaus telesilaus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 251 797 104 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Protesilaus telesilaus1.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type142 records

Wild obs. + sensor50

Museum / vouchered88

Other4

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 3>10 km 3

8 georeferenced · 42 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 9≤10 km 23>10 km 25

57 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	29
The University of the West Indies, Trinidad and Tobagolocation not on record	10
Uniwersytet Jagiellońskilocation not on record	10
Natural History Museum Rotterdamlocation not on record	10
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	8
Zürich, CH	5
Universidad de Caldas (UCaldas)location not on record	5
Auckland, NZ	3
Brussels, BE	2
RBINS-Scientific Heritagelocation not on record	2
Universidad Tecnológica del Chocó (UTCH)location not on record	1
Denver, US	1
WCS Colombialocation not on record	1
South Kensington, GB	1

14 institutions · 88 of 88 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Protesilaus telesilaus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Dry forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.9–26.2

Seasonal swing summer↔winter3.10 °C

Max temp (day)29.6 °C 28.0–29.9

Min temp (night)22.3 °C 19.9–22.9

Precipitation214 mm/mo 195–226

Air humidity63.1 % 60.0–68.0

Moisture balance67.7 mm/mo 59.1–77.2

Vapour deficit1,154 Pa 1,040–1,320

Wind speed1.30 m/s 0.9–2.60

Cloud cover61.5 % 60.3–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)