Protesilaus protesilaus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Protesilaus

At a glance

Occurrence records186

Data sources7

Biological traits0

DNA specimens40

eDNA detections0

Sources7 archives

Databases and archives Protesilaus protesilaus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility186 records↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF186 records

DNA & barcodingBOLD40 specimens

Genome at a glanceNCBI≈1.5 Gbp

01Narrative

Protesilaus protesilaus is a species of butterfly of the family Papilionidae. It is found in the Neotropical realm. Protesilaus protesilaus and related species

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protesilaus protesilaus has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

117Tvariable

156Cmostly conserved

219Tmostly conserved

234Tmostly conserved

237Tmostly conserved

286Cmostly conserved

390Cmostly conserved

444Cmostly conserved

498Tmostly conserved

ACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACAGAATTAGGAAATCCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes6

BIN1

Most divergent pair1.8%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protesilaus molopssame genus2.7%Protesilaus telesilaussame genus3.6%Protesilaus macrosilaussame genus4.0%Protographium dioxippussame family5.3%Protographium marchandisame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Protesilaus protesilaus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 512 573 791 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Protesilaus protesilaus1.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type186 records

Wild obs. + sensor26

Museum / vouchered149

Other11

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1≤1 km 3>10 km 3

7 georeferenced · 19 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 1≤1 km 5≤10 km 29>10 km 55

90 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	45
Uniwersytet Jagiellońskilocation not on record	16
Auckland, NZ	15
Natural History Museum Rotterdamlocation not on record	13
New Haven, US	12
The University of the West Indies, Trinidad and Tobagolocation not on record	11
National Biodiversity Institute, Costa Ricalocation not on record	9
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	7
Zürich, CH	5
PUC-RSlocation not on record	4
Denver, US	3
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	2
Banyoles, ES	2
Universidad del Quindío (UniQuindío)location not on record	1
Salzburg, AT	1
Universidad de Caldas (UCaldas)location not on record	1
MZLUlocation not on record	1
Colorado State Universitylocation not on record	1

18 institutions · 149 of 149 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)