Prostomis mandibularis

(Fabricius, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Prostomidae/Prostomis

At a glance

Occurrence records1 080

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Prostomis mandibularis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 080 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 080 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Prostomis mandibularis is a beetle of the family Prostomidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prostomis mandibularis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

14Gmostly conserved

40Gmostly conserved

59Cmostly conserved

124Tmostly conserved

196Amostly conserved

212Tmostly conserved

214Amostly conserved

219Cmostly conserved

220Cmostly conserved

232Cmostly conserved

259Cmostly conserved

280Gmostly conserved

283Tmostly conserved

302Gmostly conserved

304Tmostly conserved

316Cmostly conserved

328Amostly conserved

343Cmostly conserved

346Cmostly conserved

421Amostly conserved

433Amostly conserved

443Tmostly conserved

450Cmostly conserved

451Cmostly conserved

454Amostly conserved

469Amostly conserved

474Tmostly conserved

490Tmostly conserved

517Tmostly conserved

522Tmostly conserved

542Cmostly conserved

547Cmostly conserved

554Amostly conserved

556Cmostly conserved

559Gmostly conserved

571Tmostly conserved

576Tmostly conserved

580Tmostly conserved

581Cmostly conserved

584Amostly conserved

585Cmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

589Cmostly conserved

590Cmostly conserved

591Gmostly conserved

593Amostly conserved

597Tmostly conserved

598Amostly conserved

601Tmostly conserved

602Amostly conserved

603Cmostly conserved

604Cmostly conserved

606Cmostly conserved

607Cmostly conserved

608Tmostly conserved

609Tmostly conserved

610Cmostly conserved

611Tmostly conserved

612Tmostly conserved

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

617Cmostly conserved

618Cmostly conserved

619Amostly conserved

621Cmostly conserved

622Amostly conserved

623Gmostly conserved

624Gmostly conserved

627Gmostly conserved

628Tmostly conserved

633Amostly conserved

634Cmostly conserved

635Cmostly conserved

636Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

642Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

648Amostly conserved

650Cmostly conserved

653Tvariable

654Tmostly conserved

656Tmostly conserved

657Tmostly conserved

658Tmostly conserved

GACCTTATACTTAGTTTTTGGTGCTTGGGCAGGAATAGTGGGAACATCTCTTAGTCTACTAATCCGATCTGAACTAGGCAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes3

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Evodinus monticolasame order17.2%Phymatodes hirtellussame order17.2%Dorcasta dasycerasame order17.5%Amischa decipienssame order17.5%Xenostrongylus variegatussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 080 records

Wild obs. + sensor622

Museum / vouchered325

Fossil14

Other119

Origin

Native156

Range

Area of Occupancy AOO1 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 113≤1 km 29≤10 km 291>10 km 13

446 georeferenced · 176 without coordinates

Open the mapobservation + sensor622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 26≤10 km 248>10 km 6

280 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	58
Muzeum Górnośląskie w Bytomiulocation not on record	24
Bern, CH	23
University of Alabamalocation not on record	17
Zürich, CH	12
Geneva, CH	11
Provincia di Livornolocation not on record	8
Salzburg, AT	7
Natural History Museum Rotterdamlocation not on record	7
Fribourg, CH	6
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	5
Dhaka, BD	4
MZLUlocation not on record	4
NMOKlocation not on record	3
South Kensington, GB	3
OSUClocation not on record	2
Paro, BT	2
Naturmuseum St. Gallenlocation not on record	2
Paris, FR	1
IFR-DNFlocation not on record	1
Research Collection of Julien Touroultlocation not on record	1
ZSMlocation not on record	1
Vitoria, ES	1
LSMlocation not on record	1

24 institutions · 204 of 325 vouchered records shown · 121 without an institution code

09Environmental DNA11 detections

Where the DNA of Prostomis mandibularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

From Pinus nigra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C 4.60–10.3

Seasonal swing summer↔winter19.1 °C

Max temp (day)13.6 °C 7.20–14.8

Min temp (night)3.40 °C 1.20–4.40

Precipitation202 mm/mo 67.0–202

Air humidity62.9 % 58.0–70.0

Moisture balance97.4 mm/mo -18.2–106

Vapour deficit436 Pa 256–528

Wind speed5.40 m/s 3.50–5.40

Cloud cover39.2 % 38.9–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prostomis mandibularis

At a glance

Sources7 archives

At a glance

Record type1 080 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 080 records