Amischa decipiens

(Sharp, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Amischa

At a glance

Occurrence records913

Data sources5

Biological traits0

DNA specimens75

eDNA detections627

Sources5 archives

Databases and archives Amischa decipiens's data was compiled from.

GBIFGlobal Biodiversity Information Facility913 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI627 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF913 records

Environmental DNA4 datasets · 12 countries627 detections

DNA & barcodingBOLD75 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amischa decipiens has left across the world's sequence archives.

At a glance

DNA specimens75

BINs2

Marker genes3

eDNA detections627

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

281Cmostly conserved

579Cmostly conserved

606Tmostly conserved

645Cmostly conserved

ACCTTATATTTCATTTTTGGAGCATGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATCCGTGCTGAATTAGGAAATCCCGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes6

BINs2

Most divergent pair9.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amischa forcipatasame genus8.9%Atheta aemulasame family10.2%Amischa analissame genus10.8%Amischa bifoveolatasame genus10.8%Atheta monticolasame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type913 records

Wild obs. + sensor613

Museum / vouchered279

Cultivated / captive12

Other9

Range

Area of Occupancy AOO2 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 306≤1 km 145≤10 km 118>10 km 1

570 georeferenced · 43 without coordinates

Open the mapobservation + sensor613

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 100≤1 km 79≤10 km 27

206 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence279

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	70
Tartu, EE	35
University of Guelph, Centre for Biodiversity Genomicslocation not on record	32
Metsähallituslocation not on record	30
Helsinki, FI	16
Tilburg, NL	13
NMBU:MINAlocation not on record	12
ZSMlocation not on record	9
Trondheim, NO	5
NHMOlocation not on record	3
BioFokuslocation not on record	2
Akademia Pomorska w Słupskulocation not on record	2
Kuopio, FI	2
IFR-DNFlocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
CBDClocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
LSMlocation not on record	1
South Kensington, GB	1
Copenhagen, DK	1
University of Oulu, Zoological Museumlocation not on record	1

21 institutions · 239 of 279 vouchered records shown · 40 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA627 detections

Where the DNA of Amischa decipiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found627

Studies independent surveys4

Countries12

Verifiable raw sequence linked221

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 627 detections have coordinates

Open the map12 countries0

4. Native Grassland | 4.4. Temperate Grassland5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…14. Artificial - Terrestrial|14.1 Arable Land1. Forest & Woodland|1.4. Temperate Forest4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 7.50–16.5

Seasonal swing summer↔winter16.5 °C

Max temp (day)17.5 °C 11.9–20.2

Min temp (night)10.9 °C 2.80–13.2

Precipitation64.4 mm/mo 40.9–77.8

Air humidity60.7 % 59.2–62.8

Moisture balance-54.3 mm/mo -69.1–0.2

Vapour deficit647 Pa 438–725

Wind speed4.10 m/s 3.20–5.50

Cloud cover43.6 % 38.6–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 625 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)