Polyura athamas

(Drury, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Polyura

At a glance

Occurrence records1 251

Data sources8

Biological traits0

DNA specimens19

eDNA detections13

Sources8 archives

Databases and archives Polyura athamas's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 251 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT2n = 26

01Narrative

Polyura athamas, the common nawab, is a species of fast-flying canopy butterfly found in tropical Asia. It belongs to the Charaxinae (rajahs and nawabs) in the brush-footed butterfly family (Nymphalidae). It occurs in the Himalayas from Kashmir to Sikkim, the hills of central India and the Eastern Ghats, the Western Ghats and southern India, Sri Lanka, Assam, Cachar, and via Myanmar, Cambodia and the Tenasserim Hills far into Indonesia. In August 2016 a specimen was spotted and caught in Palawan, Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polyura athamas has left across the world's sequence archives.

At a glance

DNA specimens19

BINs5

Marker genes1

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs5

Most divergent pair2.7%

Where individuals differ — all 47 variable positions, in barcode order

70Tmostly conserved

82Tmostly conserved

106Tmostly conserved

112Tmostly conserved

118Tmostly conserved

142Tmostly conserved

157Tmostly conserved

169Tmostly conserved

181Tmostly conserved

197Tvariable

205Tmostly conserved

212Tmostly conserved

220Tmostly conserved

223Cmostly conserved

238Cmostly conserved

287Cvariable

304Cmostly conserved

313Tmostly conserved

327Gmostly conserved

328Amostly conserved

329Tmostly conserved

346Tmostly conserved

368Avariable

391Cvariable

397Cmostly conserved

400Tmostly conserved

403Tmostly conserved

421Tmostly conserved

424Cmostly conserved

427Tmostly conserved

433Amostly conserved

451Tmostly conserved

460Tmostly conserved

499Tmostly conserved

508Amostly conserved

509Tmostly conserved

510Gmostly conserved

541Amostly conserved

542Cvariable

547Tmostly conserved

548Tmostly conserved

556Tmostly conserved

565Tmostly conserved

578Tmostly conserved

604Amostly conserved

622Amostly conserved

628Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTTTAATTATTCGAACTGAATTAGGAAATCCAGGATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polyura hebesame genus2.3%Polyura arjasame genus3.2%Polyura schreibersame genus5.0%Polyura eudamippussame genus5.0%Polyura delphissame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Polyura athamas carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor1 111

Museum / vouchered140

Range

Area of Occupancy AOO3 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 248≤1 km 298≤10 km 123>10 km 243

912 georeferenced · 199 without coordinates

Open the mapobservation + sensor1 111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤1 km 1≤10 km 27>10 km 62

90 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Tribhuvan Universitylocation not on record	25
Cambridge, US	18
Auckland, NZ	13
Sanda, JP	13
New Haven, US	8
Zürich, CH	5
Helsinki, FI	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Museum Zoologicum Bogoriense, Bogorlocation not on record	4
Cape Town, ZA	2
Tomioka, JP	2
Denver, US	1
Durban Natural Science Museumlocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Toronto, CA	1

15 institutions · 104 of 140 vouchered records shown · 36 without an institution code

09Environmental DNA13 detections

Where the DNA of Polyura athamas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–26.5

Seasonal swing summer↔winter1.40 °C

Max temp (day)24.2 °C 24.2–30.1

Min temp (night)16.0 °C 16.0–22.6

Precipitation257 mm/mo 223–257

Air humidity64.9 % 64.9–69.4

Moisture balance142 mm/mo 72.8–142

Vapour deficit822 Pa 822–1,167

Wind speed1.30 m/s 1.30–1.60

Cloud cover70.8 % 33.7–70.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polyura athamas

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 251 records