Polyura eudamippus

(Doubleday, 1843) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Polyura

At a glance

Occurrence records463

Data sources8

Biological traits0

DNA specimens7

eDNA detections8

Sources8 archives

Databases and archives Polyura eudamippus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT2n = 26

01Narrative

Polyura eudamippus, the great nawab, is a butterfly found in India and the Indomalayan realm that belongs to the rajahs and nawabs group (subfamily Charaxinae) of the brush-footed butterflies (family Nymphalidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polyura eudamippus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes2

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

4Cmostly conserved

57Amostly conserved

78Tvariable

87Avariable

99Tmostly conserved

102Cmostly conserved

124Gmostly conserved

126Tmostly conserved

127Amostly conserved

128Cmostly conserved

129Amostly conserved

165Avariable

222Tvariable

249Tvariable

264Tvariable

294Tmostly conserved

476Avariable

525Tmostly conserved

528Cmostly conserved

532Tmostly conserved

534Amostly conserved

555Tmostly conserved

561Amostly conserved

564Tmostly conserved

573Tmostly conserved

577Tmostly conserved

585Tmostly conserved

595Tmostly conserved

597Amostly conserved

603Cvariable

606Tmostly conserved

615Tmostly conserved

621Amostly conserved

630Avariable

636Tmostly conserved

640Tmostly conserved

642Amostly conserved

651Tmostly conserved

ACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTTTAATTATTCGAACTGAATTAGGTAATCCTGGATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes3

BINs3

Most divergent pair4.4%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polyura nepenthessame genus3.2%Polyura dolonsame genus3.4%Polyura narcaeussame genus4.0%Polyura delphissame genus4.3%Polyura arjasame genus4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_088764 ↗ · 13 protein · 22 tRNA · 2 rRNA

nad2cox1cox2atp8atp6cox3nad3nad5nad4nad4lnad6cobnad1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Polyura eudamippus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type463 records

Wild obs. + sensor423

Museum / vouchered38

Other2

Range

Area of Occupancy AOO1 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 104≤1 km 123≤10 km 60>10 km 67

354 georeferenced · 69 without coordinates

Open the mapobservation + sensor423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 2≤10 km 13>10 km 6

21 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Tribhuvan Universitylocation not on record	8
New Haven, US	7
Zürich, CH	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Helsinki, FI	4
Auckland, NZ	4
Tomioka, JP	2
Private Collection of Goeran Sjoeberglocation not on record	1
Cape Town, ZA	1

9 institutions · 38 of 38 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Polyura eudamippus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.4–19.2

Seasonal swing summer↔winter13.0 °C

Max temp (day)21.2 °C 20.4–22.3

Min temp (night)15.1 °C 13.3–15.3

Precipitation305 mm/mo 90.1–431

Air humidity65.7 % 65.4–69.1

Moisture balance198 mm/mo 29.7–299

Vapour deficit769 Pa 620–769

Wind speed1.20 m/s 1.00–2.20

Cloud cover54.6 % 51.4–73.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)